VMAT1 (SLC18A1) (NM_001142325) Human Untagged Clone

CAT#: SC325972

SLC18A1 (untagged)-Human solute carrier family 18 (vesicular monoamine), member 1 (SLC18A1), transcript variant 4


  "NM_001142325" in other vectors (6)

Reconstitution Protocol

USD 790.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SLC18A1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SLC18A1
Synonyms CGAT; VAT1; VMAT1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001142325, the custom clone sequence may differ by one or more nucleotides


ATGCTCCGGACCATTCTGGATGCTCCCCAGCGGTTGCTGAAGGAGGGGAGAGCGTCCCGGCAGCTGGTGC
TGGTGGTGGTATTCGTCGCTTTGCTCCTGGACAACATGCTGTTTACTGTGGTGGTGCCAATTGTGCCCAC
CTTCCTATATGACATGGAGTTCAAAGAAGTCAACTCTTCTCTGCACCTCGGCCATGCCGGAAGTTCCCCA
CATGCCCTCGCCTCTCCTGCCTTTTCCACCATCTTCTCCTTCTTCAACAACAACACCGTGGCTGTTGAAG
AAAGCGTACCTAGTGGAATAGCATGGATGAATGACACTGCCAGCACCATCCCACCTCCAGCCACTGAAGC
CATCTCAGCTCATAAAAACAACTGCTTGCAAGGCACAGGTTTCTTGGAGGAAGAGATTACCCGGGTCGGG
GTTCTGTTTGCTTCAAAGGCTGTGATGCAACTTCTGGTCAACCCATTCGTGGGCCCTCTCACCAACAGGA
TTGGATATCATATCCCCATGTTTGCTGGCTTTGTTATCATGTTTCTCTCCACAGTTATGTTTGCTTTTTC
TGGGACCTATACTCTACTCTTTGTGGCCCGAACCCTTCAAGGCATTGGATCTTCATTTTCATCTGTTGCA
GGTCTTGGAATGCTGGCCAGTGTCTACACTGATGACCATGAGAGAGGACGAGCCATGGGAACTGCTCTGG
GGGGCCTGGCCTTGGGGTTGCTGGTGGGAGCTCCCTTTGGAAGTGTAATGTACGAGTTTGTTGGGAAGTC
TGCACCCTTCCTCATCCTGGCCTTCCTGGCACTACTGGATGGAGCACTCCAGCTTTGCATCCTACAGCCT
TCCAAAGTCTCTCCTGAGAGTGCCAAGGGGACTCCCCTCTTTATGCTTCTCAAAGACCCTTACATCCTGG
TGGCTGCAGGGTCCATCTGCTTTGCCAACATGGGGGTGGCCATCCTGGAGCCCACACTGCCCATCTGGAT
GATGCAGACCATGTGCTCCCCCAAGTGGCAGCTGGGTCTAGCTTTCTTGCCTGCCAGTGTGTCCTACCTC
ATTGGCACCAACCTCTTTGGTGTGTTGGCCAACAAGATGGGTCGGTGGCTGTGTTCCCTAATCGGGATGC
TGGTAGTAGGTACCAGCTTGCTCTGTGTTCCTCTGGCTCACAATATTTTTGGTCTCATTGGCCCCAATGC
AGGGCTTGGCCTTGCCATAGGCATGGTGGATTCTTCTATGATGCCCATCATGGGGCACCTGGTGGATCTA
CGCCACACCTCGGTGTATGGGAGTGTCTACGCCATCGCTGATGTGGCTTTTTGCATGGGCTTTGCTATAG
GCTATTCTGAGTCAGGACTGCCCCATGGAGACCCGGATGTATGCAACCCAGAAGCCCACGAAGGAATTTC
CTCTGGGGGAGGACAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001142325
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001142325.1, NP_001135797.1
RefSeq Size 2840 bp
RefSeq ORF 1419 bp
Locus ID 6570
Cytogenetics 8p21.3
Protein Families Transmembrane
Protein Pathways Parkinson's disease
Gene Summary 'The vesicular monoamine transporter acts to accumulate cytosolic monoamines into vesicles, using the proton gradient maintained across the vesicular membrane. Its proper function is essential to the correct activity of the monoaminergic systems that have been implicated in several human neuropsychiatric disorders. The transporter is a site of action of important drugs, including reserpine and tetrabenazine (Peter et al., 1993 [PubMed 7905859]). See also SLC18A2 (MIM 193001).[supplied by OMIM, Mar 2008]'
Transcript Variant: This variant (4), also known as VMAT1delta15, lacks an alternate exon in the 3' coding region resulting in a frameshift, compared to variant 1. The resulting isoform (c) has a shorter and distinct C-terminus, compared to isoform a. CCDS Note: This variant represents the VMAT1delta15 variant described in PMID:16326835. There are no publicly available transcripts representing it, but it was cloned and characterized in the above publication.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.