PKR (EIF2AK2) (NM_001135652) Human Untagged Clone

CAT#: SC326008

EIF2AK2 (untagged)-Human eukaryotic translation initiation factor 2-alpha kinase 2 (EIF2AK2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: EIF2AK2
• Synonyms: EIF2AK1; PKR; PPP1R83; PRKR
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001135652, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTGGTGATCTTTCAGCAGGTTTCTTCATGGAGGAACTTAATACATACCGTCAGAAGCAGGGAGTAG
  TACTTAAATATCAAGAACTGCCTAATTCAGGACCTCCACATGATAGGAGGTTTACATTTCAAGTTATAAT
  AGATGGAAGAGAATTTCCAGAAGGTGAAGGTAGATCAAAGAAGGAAGCAAAAAATGCCGCAGCCAAATTA
  GCTGTTGAGATACTTAATAAGGAAAAGAAGGCAGTTAGTCCTTTATTATTGACAACAACGAATTCTTCAG
  AAGGATTATCCATGGGGAATTACATAGGCCTTATCAATAGAATTGCCCAGAAGAAAAGACTAACTGTAAA
  TTATGAACAGTGTGCATCGGGGGTGCATGGGCCAGAAGGATTTCATTATAAATGCAAAATGGGACAGAAA
  GAATATAGTATTGGTACAGGTTCTACTAAACAGGAAGCAAAACAATTGGCCGCTAAACTTGCATATCTTC
  AGATATTATCAGAAGAAACCTCAGTGAAATCTGACTACCTGTCCTCTGGTTCTTTTGCTACTACGTGTGA
  GTCCCAAAGCAACTCTTTAGTGACCAGCACACTCGCTTCTGAATCATCATCTGAAGGTGACTTCTCAGCA
  GATACATCAGAGATAAATTCTAACAGTGACAGTTTAAACAGTTCTTCGTTGCTTATGAATGGTCTCAGAA
  ATAATCAAAGGAAGGCAAAAAGATCTTTGGCACCCAGATTTGACCTTCCTGACATGAAAGAAACAAAGTA
  TACTGTGGACAAGAGGAAGGCGGAGCGTGAAGTAAAAGCATTGGCAAAACTTGATCATGTAAATATTGTT
  CACTACAATGGCTGTTGGGATGGATTTGATTATGATCCTGAGACCAGTGATGATTCTCTTGAGAGCAGTG
  ATTATGATCCTGAGAACAGCAAAAATAGTTCAAGGTCAAAGACTAAGTGCCTTTTCATCCAAATGGAATT
  CTGTGATAAAGGGACCTTGGAACAATGGATTGAAAAAAGAAGAGGCGAGAAACTAGACAAAGTTTTGGCT
  TTGGAACTCTTTGAACAAATAACAAAAGGGGTGGATTATATACATTCAAAAAAATTAATTCATAGAGATC
  TTAAGCCAAGTAATATATTCTTAGTAGATACAAAACAAGTAAAGATTGGAGACTTTGGACTTGTAACATC
  TCTGAAAAATGATGGAAAGCGAACAAGGAGTAAGGGAACTTTGCGATACATGAGCCCAGAACAGATTTCT
  TCGCAAGACTATGGAAAGGAAGTGGACCTCTACGCTTTGGGGCTAATTCTTGCTGAACTTCTTCATGTAT
  GTGACACTGCTTTTGAAACATCAAAGTTTTTCACAGACCTACGGGATGGCATCATCTCAGATATATTTGA
  TAAAAAAGAAAAAACTCTTCTACAGAAATTACTCTCAAAGAAACCTGAGGATCGACCTAACACATCTGAA
  ATACTAAGGACCTTGACTGTGTGGAAGAAAAGCCCAGAGAAAAATGAACGACACACATGTTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001135652
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001135652.2, NP_001129124.1
• RefSeq Size: 3697 bp
• RefSeq ORF: 1533 bp
• Locus ID: 5610
• Cytogenetics: 2p22.2
• Protein Families: Druggable Genome, Protein Kinase, Transcription Factors
• Gene Summary: 'The protein encoded by this gene is a serine/threonine protein kinase that is activated by autophosphorylation after binding to dsRNA. The activated form of the encoded protein can phosphorylate translation initiation factor EIF2S1, which in turn inhibits protein synthesis. This protein is also activated by manganese ions and heparin. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]'
  Transcript Variant: This variant (3) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a. The 5' UTR splice pattern of this transcript has not been determined. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.