GATA2 (NM_001145662) Human Untagged Clone
CAT#: SC326481
GATA2 (untagged)-Human GATA binding protein 2 (GATA2), transcript variant 3, mRNA
"NM_001145662" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GATA2 |
Synonyms | DCML; IMD21; MONOMAC; NFE1B |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001145662, the custom clone sequence may differ by one or more nucleotides
ATGGAGGTGGCGCCCGAGCAGCCGCGCTGGATGGCGCACCCGGCCGTGCTGAATGCGCAGCACCCCGACT CACACCACCCGGGCCTGGCGCACAACTACATGGAACCCGCGCAGCTGCTGCCTCCAGACGAGGTGGACGT CTTCTTCAATCACCTCGACTCGCAGGGCAACCCCTACTATGCCAACCCCGCTCACGCGCGGGCGCGCGTC TCCTACAGCCCCGCGCACGCCCGCCTGACCGGAGGCCAGATGTGCCGCCCACACTTGTTGCACAGCCCGG GTTTGCCCTGGCTGGACGGGGGCAAAGCAGCCCTCTCTGCCGCTGCGGCCCACCACCACAACCCCTGGAC CGTGAGCCCCTTCTCCAAGACGCCACTGCACCCCTCAGCTGCTGGAGGCCCTGGAGGCCCACTCTCTGTG TACCCAGGGGCTGGGGGTGGGAGCGGGGGAGGCAGCGGGAGCTCAGTGGCCTCCCTCACCCCTACAGCAG CCCACTCTGGCTCCCACCTTTTCGGCTTCCCACCCACGCCACCCAAAGAAGTGTCTCCTGACCCTAGCAC CACGGGGGCTGCGTCTCCAGCCTCATCTTCCGCGGGGGGTAGTGCAGCCCGAGGAGAGGACAAGGACGGC GTCAAGTACCAGGTGTCACTGACGGAGAGCATGAAGATGGAAAGTGGCAGTCCCCTGCGCCCAGGCCTAG CTACTATGGGCACCCAGCCTGCTACACACCACCCCATCCCCACCTACCCCTCCTATGTGCCGGCGGCTGC CCACGACTACAGCAGCGGACTCTTCCACCCCGGAGGCTTCCTGGGGGGACCGGCCTCCAGCTTCACCCCT AAGCAGCGCAGCAAGGCTCGTTCCTGTTCAGAAGGCCGGGAGTGTGTCAACTGTGGGGCCACAGCCACCC CTCTCTGGCGGCGGGACGGCACCGGCCACTACCTGTGCAATGCCTGTGGCCTCTACCACAAGATGAATGG GCAGAACCGACCACTCATCAAGCCCAAGCGAAGACTGACGACAACCACCACCTTATGGCGCCGAAACGCC AACGGGGACCCTGTCTGCAACGCCTGTGGCCTCTACTACAAGCTGCACAATGTTAACAGGCCACTGACCA TGAAGAAGGAAGGGATCCAGACTCGGAACCGGAAGATGTCCAACAAGTCCAAGAAGAGCAAGAAAGGGGC GGAGTGCTTCGAGGAGCTGTCAAAGTGCATGCAGGAGAAGTCATCCCCCTTCAGTGCAGCTGCCCTGGCT GGACACATGGCACCTGTGGGCCACCTCCCGCCCTTCAGCCACTCCGGACACATCCTGCCCACTCCGACGC CCATCCACCCCTCCTCCAGCCTCTCCTTCGGCCACCCCCACCCGTCCAGCATGGTGACCGCCATGGGCTA G |
Restriction Sites | SgfI-MluI |
ACCN | NM_001145662 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001145662.1, NP_001139134.1 |
RefSeq Size | 3263 bp |
RefSeq ORF | 1401 bp |
Locus ID | 2624 |
Cytogenetics | 3q21.3 |
Protein Families | Adult stem cells, Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors |
Gene Summary | 'This gene encodes a member of the GATA family of zinc-finger transcription factors that are named for the consensus nucleotide sequence they bind in the promoter regions of target genes. The encoded protein plays an essential role in regulating transcription of genes involved in the development and proliferation of hematopoietic and endocrine cell lineages. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Mar 2009]' Transcript Variant: This variant (3) differs in the 5' UTR and uses an alternate splice site in the CDS but maintains the reading frame, compared to variant 1. This variant encodes isoform 2, which is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227514 | GATA2 (Myc-DDK-tagged)-Human GATA binding protein 2 (GATA2), transcript variant 3 |
USD 420.00 |
|
RG227514 | GATA2 (GFP-tagged) - Human GATA binding protein 2 (GATA2), transcript variant 3 |
USD 460.00 |
|
RC227514L1 | Lenti-ORF clone of GATA2 (Myc-DDK-tagged)-Human GATA binding protein 2 (GATA2), transcript variant 3 |
USD 768.00 |
|
RC227514L2 | Lenti-ORF clone of GATA2 (mGFP-tagged)-Human GATA binding protein 2 (GATA2), transcript variant 3 |
USD 620.00 |
|
RC227514L3 | Lenti-ORF clone of GATA2 (Myc-DDK-tagged)-Human GATA binding protein 2 (GATA2), transcript variant 3 |
USD 620.00 |
|
RC227514L4 | Lenti-ORF clone of GATA2 (mGFP-tagged)-Human GATA binding protein 2 (GATA2), transcript variant 3 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review