NCR3 (NM_001145467) Human Untagged Clone

CAT#: SC326537

NCR3 (untagged)-Human natural cytotoxicity triggering receptor 3 (NCR3), transcript variant 3, mRNA

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NCR3
• Synonyms: 1C7; CD337; LY117; MALS; NKp30
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001145467, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCTGGATGCTGTTGCTCATCTTGATCATGGTCCATCCAGGATCCTGTGCTCTCTGGGTGTCCCAGC
  CCCCTGAGATTCGTACCCTGGAAGGATCCTCTGCCTTCCTGCCCTGCTCCTTCAATGCCAGCCAAGGGAG
  ACTGGCCATTGGCTCCGTCACGTGGTTCCGAGATGAGGTGGTTCCAGGGAAGGAGGTGAGGAATGGAACC
  CCAGAGTTCAGGGGCCGCCTGGCCCCACTTGCTTCTTCCCGTTTCCTCCATGACCACCAGGCTGAGCTGC
  ACATCCGGGACGTGCGAGGCCATGACGCCAGCATCTACGTGTGCAGAGTGGAGGTGCTGGGCCTTGGTGT
  CGGGACAGGGAATGGGACTCGGCTGGTGGTGGAGAAAGAACATCCTCAGCTAGGGGCTGGTACAGTCCTC
  CTCCTTCGGGCTGGATTCTATGCTGTCAGCTTTCTCTCTGTGGCCGTGGGCAGCACCGTCTATTACCAGG
  GCAAATGCCACTGTCACATGGGAACACACTGCCACTCCTCAGATGGGCCCCGAGGAGTGATTCCAGAGCC
  CAGATGTCCCTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001145467
• ORF Size: 573 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001145467.1, NP_001138939.1
• RefSeq Size: 875
• RefSeq ORF: 573
• Locus ID: 259197
• Protein Families: Druggable Genome, ES Cell Differentiation/IPS
• Protein Pathways: Natural killer cell mediated cytotoxicity
• Gene Summary: The protein encoded by this gene is a natural cytotoxicity receptor (NCR) that may aid NK cells in the lysis of tumor cells. The encoded protein interacts with CD3-zeta (CD247), a T-cell receptor. A single nucleotide polymorphism in the 5' untranslated region of this gene has been associated with mild malaria suceptibility. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
  Transcript Variant: This variant (3) uses an alternate splice site in the 3' coding region compared to variant 1, that results in a frameshift. It encodes isoform c, which has a shorter and distinct C-terminus compared to isoform a.