PFKFB3 (NM_001145443) Human Untagged Clone
CAT#: SC326585
PFKFB3 (untagged)-Human 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 (PFKFB3), transcript variant 2, mRNA
"NM_001145443" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PFKFB3 |
Synonyms | iPFK-2; IPFK2; PFK2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001145443, the custom clone sequence may differ by one or more nucleotides
ATGCCCTTCAGGAAAGCCTGTGGGCCAAAGCTGACCAACTCCCCCACCGTCATCGTCATGGTGGGCCTCC CCGCCCGGGGCAAGACCTACATCTCCAAGAAGCTGACTCGCTACCTCAACTGGATTGGCGTCCCCACAAA AGTGTTCAACGTCGGGGAGTATCGCCGGGAGGCTGTGAAGCAGTACAGCTCCTACAACTTCTTCCGCCCC GACAATGAGGAAGCCATGAAAGTCCGGAAGCAATGTGCCTTAGCTGCCTTGAGAGATGTCAAAAGCTACC TGGCGAAAGAAGGGGGACAAATTGCGGTTTTCGATGCCACCAATACTACTAGAGAGAGGAGACACATGAT CCTTCATTTTGCCAAAGAAAATGACTTTAAGGCGTTTTTCATCGAGTCGGTGTGCGACGACCCTACAGTT GTGGCCTCCAATATCATGGAAGTTAAAATCTCCAGCCCGGATTACAAAGACTGCAACTCGGCAGAAGCCA TGGACGACTTCATGAAGAGGATCAGTTGCTATGAAGCCAGCTACCAGCCCCTCGACCCCGACAAATGCGA CAGGGACTTGTCGCTGATCAAGGTGATTGACGTGGGCCGGAGGTTCCTGGTGAACCGGGTGCAGGACCAC ATCCAGAGCCGCATCGTGTACTACCTGATGAACATCCACGTGCAGCCGCGTACCATCTACCTGTGCCGGC ACGGCGAGAACGAGCACAACCTCCAGGGCCGCATCGGGGGCGACTCAGGCCTGTCCAGCCGGGGCAAGAA GTTTGCCAGTGCTCTGAGCAAGTTCGTGGAGGAGCAGAACCTGAAGGACCTGCGCGTGTGGACCAGCCAG CTGAAGAGCACCATCCAGACGGCCGAGGCGCTGCGGCTGCCCTACGAGCAGTGGAAGGCGCTCAATGAGA TCGACGCGGGCGTCTGTGAGGAGCTGACCTACGAGGAGATCAGGGACACCTACCCTGAGGAGTATGCGCT GCGGGAGCAGGACAAGTACTATTACCGCTACCCCACCGGGGAGTCCTACCAGGACCTGGTCCAGCGCTTG GAGCCAGTGATCATGGAGCTGGAGCGGCAGGAGAATGTGCTGGTCATCTGCCACCAGGCCGTCCTGCGCT GCCTGCTTGCCTACTTCCTGGATAAGAGTGCAGAGGAGATGCCCTACCTGAAATGCCCTCTTCACACCGT CCTGAAACTGACGCCTGTCGCTTATGGCTGCCGTGTGGAATCCATCTACCTGAACGTGGAGTCCGTCTGC ACACACCGGGAGAGGTCAGAGGATGCAAAGAAGGGACCTAACCCGCTCATGAGACGCAATAGTGTCACCC CGCTAGCCAGCCCCGAACCCACCAAAAAGCCTCGCATCAACAGCTTTGAGGAGCATGTGGCCTCCACCTC GGCCGCCCTGCCCAGCTGCCTGCCCCCGGAGGTGCCCACGCAGCTGCCTGGACAAAACATGAAAGGCTCC CGGAGCAGCGCTGACTCCTCCAGGAAACACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001145443 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001145443.2, NP_001138915.1 |
RefSeq Size | 4226 bp |
RefSeq ORF | 1503 bp |
Locus ID | 5209 |
Cytogenetics | 10p15.1 |
Protein Families | Druggable Genome |
Protein Pathways | Fructose and mannose metabolism |
Gene Summary | 'The protein encoded by this gene belongs to a family of bifunctional proteins that are involved in both the synthesis and degradation of fructose-2,6-bisphosphate, a regulatory molecule that controls glycolysis in eukaryotes. The encoded protein has a 6-phosphofructo-2-kinase activity that catalyzes the synthesis of fructose-2,6-bisphosphate (F2,6BP), and a fructose-2,6-biphosphatase activity that catalyzes the degradation of F2,6BP. This protein is required for cell cycle progression and prevention of apoptosis. It functions as a regulator of cyclin-dependent kinase 1, linking glucose metabolism to cell proliferation and survival in tumor cells. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2016]' Transcript Variant: This variant (2) uses an alternate 5' terminal exon compared to variant 1. The resulting isoform (2) has a shorter and distinct N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227482 | PFKFB3 (Myc-DDK-tagged)-Human 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 (PFKFB3), transcript variant 2 |
USD 480.00 |
|
RG227482 | PFKFB3 (GFP-tagged) - Human 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 (PFKFB3), transcript variant 2 |
USD 530.00 |
|
RC227482L1 | Lenti-ORF clone of PFKFB3 (Myc-DDK-tagged)-Human 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 (PFKFB3), transcript variant 2 |
USD 680.00 |
|
RC227482L2 | Lenti-ORF clone of PFKFB3 (mGFP-tagged)-Human 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 (PFKFB3), transcript variant 2 |
USD 680.00 |
|
RC227482L3 | Lenti-ORF clone of PFKFB3 (Myc-DDK-tagged)-Human 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 (PFKFB3), transcript variant 2 |
USD 680.00 |
|
RC227482L4 | Lenti-ORF clone of PFKFB3 (mGFP-tagged)-Human 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 (PFKFB3), transcript variant 2 |
USD 680.00 |
{0} Product Review(s)
Be the first one to submit a review