Inositol Hexakisphosphate Kinase 2 (IP6K2) (NM_001146178) Human Untagged Clone

CAT#: SC326666

IP6K2 (untagged)-Human inositol hexakisphosphate kinase 2 (IP6K2) transcript variant 5


  "NM_001146178" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "IP6K2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol IP6K2
Synonyms IHPK2; InsP6K2; PIUS
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001146178, the custom clone sequence may differ by one or more nucleotides
ATGAGCCCAGCCTTCAGGGCCATGGATGTGGAGCCCCGCGCCAAAGGCGTCCTTCTGGAG
CCCTTTGTCCACCAGGTCGGGGGGCACTCATGCGTGCTCCGCTTCAATGAGACAACCCTG
TGCAAGCCCCTGGTCCCAAGGGAACATCAGTTCTACGAGACCCTCCCTGCTGAGATGCGC
AAATTCACTCCCCAGTACAAAGGGGACATCAGCAGCCACCAGCATGGTGGGGTCTTTGTT
GGGGAGTGGGGGAGTCTTTTG
Restriction Sites Please inquire     
ACCN NM_001146178
ORF Size 264 bp
Insert Size 1324
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001146178.1, NP_001139650.1
RefSeq Size 1324
RefSeq ORF 264
Locus ID 51447
Protein Families Druggable Genome
Gene Summary This gene encodes a protein that belongs to the inositol phosphokinase (IPK) family. This protein is likely responsible for the conversion of inositol hexakisphosphate (InsP6) to diphosphoinositol pentakisphosphate (InsP7/PP-InsP5). It may also convert 1,3,4,5,6-pentakisphosphate (InsP5) to PP-InsP4 and affect the growth suppressive and apoptotic activities of interferon-beta in some ovarian cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (5) differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (c) has a shorter and distinct C-terminus compared to isoform a. Variants 5 and 6 encode the same isoform (c).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.