Inositol Hexakisphosphate Kinase 2 (IP6K2) (NM_001146179) Human Untagged Clone

CAT#: SC326667

IP6K2 (untagged)-Human inositol hexakisphosphate kinase 2 (IP6K2) transcript variant 6

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IP6K2
• Synonyms: IHPK2; InsP6K2; PIUS
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001146179, the custom clone sequence may differ by one or more nucleotides
  ATGAGCCCAGCCTTCAGGGCCATGGATGTGGAGCCCCGCGCCAAAGGCGTCCTTCTGGAG
  CCCTTTGTCCACCAGGTCGGGGGGCACTCATGCGTGCTCCGCTTCAATGAGACAACCCTG
  TGCAAGCCCCTGGTCCCAAGGGAACATCAGTTCTACGAGACCCTCCCTGCTGAGATGCGC
  AAATTCACTCCCCAGTACAAAGGGGACATCAGCAGCCACCAGCATGGTGGGGTCTTTGTT
  GGGGAGTGGGGGAGTCTTTTG
  
• Restriction Sites: Please inquire
• ACCN: NM_001146179
• ORF Size: 264 bp
• Insert Size: 1321
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001146179.1, NP_001139651.1
• RefSeq Size: 1321
• RefSeq ORF: 264
• Locus ID: 51447
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a protein that belongs to the inositol phosphokinase (IPK) family. This protein is likely responsible for the conversion of inositol hexakisphosphate (InsP6) to diphosphoinositol pentakisphosphate (InsP7/PP-InsP5). It may also convert 1,3,4,5,6-pentakisphosphate (InsP5) to PP-InsP4 and affect the growth suppressive and apoptotic activities of interferon-beta in some ovarian cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (6) uses an alternate in-frame splice site in the 5' UTR and differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (c) has a shorter and distinct C-terminus compared to isoform a. Variants 5 and 6 encode the same isoform (c).