HIST2H2BF (NM_001161334) Human Untagged Clone

CAT#: SC326710

HIST2H2BF (untagged)-Human histone cluster 2 H2bf (HIST2H2BF) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HIST2H2BF
• Synonyms: FLJ35099; FLJ56780; FLJ56787; MGC131639
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001161334, the custom clone sequence may differ by one or more nucleotides
  ATGCCGGATCCAGCGAAATCCGCTCCTGCTCCCAAGAAGGGCTCCAAAAAGGCTGTTACG
  AAAGTGCAGAAGAAGGACGGCAAGAAGCGCAAGCGCAGCCGCAAGGAGAGCTACTCCGTT
  TACGTGTACAAGGTGCTGAAGCAGGTCCACCCCGACACCGGCATCTCGTCCAAGGCCATG
  GGCATCATGAACTCCTTCGTCAACGACATCTTCGAGCGCATCGCGGGAGAGGCGTCCCGC
  CTGGCGCACTACAACAAGCGCTCCACCATCACATCCCGCGAGATCCAGACGGCCGTGCGC
  CTGCTGCTGCCCGGCGAGCTGGCCAAGCACGCCGTGTCCGAGGGCACCAAGGCGGTCACC
  AAGTACACCAGCTCGAAGTTAATAGGACCCATCCTTTGGAAG
  
• Restriction Sites: Please inquire
• ACCN: NM_001161334
• ORF Size: 405 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001161334.1, NP_001154806.1
• RefSeq Size: 999
• RefSeq ORF: 405
• Locus ID: 440689
• Protein Pathways: Systemic lupus erythematosus
• Gene Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around a nucleosome, an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a replication-dependent histone that is a member of the histone H2B family and is found in a histone cluster on chromosome 1. [provided by RefSeq, Aug 2015]
  Transcript Variant: This variant (2) encodes the longer isoform (b).