SCOC (NM_001153663) Human Untagged Clone
CAT#: SC326727
SCOC (untagged)-Human short coiled-coil protein (SCOC) transcript variant 2
"NM_001153663" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SCOC |
Synonyms | HRIHFB2072; SCOCO; UNC-69 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001153663, the custom clone sequence may differ by one or more nucleotides
ATGCGCAGGCGTGTATTCTCGAGTCAGGATTGGCGGGCGAGCGGCTGGGACGGGATGGGA TTCTTCTCACGGCGCACGTTCTGTGGGCGGAGTGGGCGGAGCTGCCGGGGTCAGTTGGTC CAAGTGTCCCGGCCTGAGGTGTCGGCCGGATCCCTCCTTCTCCCGGCGCCTCAAGCGGAA GACCATTCCTCAAGAATTTTGTATCCAAGGCCCAAAAGTTTGTTACCCAAGATGATGAAT GCTGACATGGATGTTGATGCTGAAAATCAAGTGGAACTGGAGGAAAAAACAAGACTTATT AATCAAGTGTTGGAACTCCAACACACACTTGAAGATCTCTCTGCAAGAGTAGATGCAGTT AAGGAAGAAAATCTGAAGCTAAAATCAGAAAACCAAGTTCTTGGACAATATATAGAAAAT CTCATGTCAGCTTCTAGTGTTTTTCAAACAACTGACACAAAAAGCAAAAGAAAG |
Restriction Sites | Please inquire |
ACCN | NM_001153663 |
ORF Size | 477 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001153663.1, NP_001147135.1 |
RefSeq Size | 1966 |
RefSeq ORF | 477 |
Locus ID | 60592 |
Gene Summary | This gene encodes a short coiled-coiled domain-containing protein that localizes to the Golgi apparatus. The encoded protein interacts with ADP-ribosylation factor-like proteins. Pseudogenes of this gene are found on chromosomes 1 and 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the coding region compared to variant 1. The encoded isoform (2) is shorter compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228092 | SCOC (Myc-DDK-tagged)-Human short coiled-coil protein (SCOC), transcript variant 2 |
USD 420.00 |
|
RG228092 | SCOC (GFP-tagged) - Human short coiled-coil protein (SCOC), transcript variant 2 |
USD 460.00 |
|
RC228092L3 | Lenti-ORF clone of SCOC (Myc-DDK-tagged)-Human short coiled-coil protein (SCOC), transcript variant 2 |
USD 620.00 |
|
RC228092L4 | Lenti-ORF clone of SCOC (mGFP-tagged)-Human short coiled-coil protein (SCOC), transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review