RAB37 (NM_001163990) Human Untagged Clone
CAT#: SC326755
RAB37 (untagged)-Human RAB37 member RAS oncogene family (RAB37) transcript variant 5
"NM_001163990" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RAB37 |
Synonyms | FLJ30284; FLJ32507 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001163990, the custom clone sequence may differ by one or more nucleotides
ATGACGGGCACGCCAGGCGCCGTTGCCACCCGGGATGGCGAGGCCCCCGAGCGCTCCCCGCCCTGCAGTC CGAGCTACGACCTCACGGGCAAGAACAAGGTGGTGACTGTGGATGGCGTGAGAGTGAAGCTGCAGATCTG GGACACCGCTGGGCAGGAACGGTTCCGAAGCGTCACCCATGCTTATTACAGAGATGCTCAGGCCTTGCTT CTGCTGTATGACATCACCAACAAATCTTCTTTCGACAACATCAGGGCCTGGCTCACTGAGATTCATGAGT ATGCCCAGAGGGACGTGGTGATCATGCTGCTAGGCAACAAGGCGGATATGAGCAGCGAAAGAGTGATCCG TTCCGAAGACGGAGAGACCTTGGCCAGGGAGTACGGTGTTCCCTTCCTGGAGACCAGCGCCAAGACTGGC ATGAATGTGGAGTTAGCCTTTCTGGCCATCGCCAAGGAACTGAAATACCGGGCCGGGCATCAGGCGGATG AGCCCAGCTTCCAGATCCGAGACTATGTAGAGTCCCAGAAGAAGCGCTCCAGCTGCTGCTCCTTCATGTG A |
Restriction Sites | SgfI-MluI |
ACCN | NM_001163990 |
ORF Size | 561 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001163990.1, NP_001157462.1 |
RefSeq Size | 2587 |
RefSeq ORF | 561 |
Locus ID | 326624 |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | Rab proteins are low molecular mass GTPases that are critical regulators of vesicle trafficking. For additional background information on Rab proteins, see MIM 179508. [supplied by OMIM, Apr 2006] Transcript Variant: This variant (5) represents use of an alternate promoter, 5' UTR and alternate start codon, compared to variant 3. The resulting isoform (5) has a distinct and shorter N-terminus, compared to isoform 3. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228120 | RAB37 (Myc-DDK-tagged)-Human RAB37, member RAS oncogene family (RAB37), transcript variant 5 |
USD 420.00 |
|
RG228120 | RAB37 (GFP-tagged) - Human RAB37, member RAS oncogene family (RAB37), transcript variant 5 |
USD 460.00 |
|
RC228120L3 | Lenti ORF clone of Human RAB37, member RAS oncogene family (RAB37), transcript variant 5, Myc-DDK-tagged |
USD 620.00 |
|
RC228120L4 | Lenti ORF clone of Human RAB37, member RAS oncogene family (RAB37), transcript variant 5, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review