Claudin 10 (CLDN10) (NM_001160100) Human Untagged Clone

CAT#: SC326772

CLDN10 (untagged)-Human claudin 10 (CLDN10) transcript variant a_v1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CLDN10
• Synonyms: CPETRL3; HELIX; OSP-L; OSPL
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001160100, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCCAGGGCGCAGATCTGGGCTCTGGTGTCTGGTGTCGGAGGGTTTGGAGCTCTCGTTGCTGCTACCA
  CGTCCAATGAGTGGAAAGTGACCACGCGAGCCTCCTCGGTGATAACAGCCACTTGGGTTTACCAGGGTCT
  GTGGATGAACTGCGCAGGTTATATACAGGCATGTAGAGGACTTATGATCGCTGCTGTCAGCCTGGGCTTC
  TTTGGTTCCATATTTGCGCTCTTTGGAATGAAGTGTACCAAAGTCGGAGGCTCCGATAAAGCCAAAGCTA
  AAATTGCTTGTTTGGCTGGGATTGTATTCATACTGTCAGGGCTGTGCTCAATGACTGGATGTTCCCTATA
  TGCAAACAAAATCACAACGGAATTCTTTGATCCTCTCTTTGTTGAGCAAAAGTATGAATTAGGAGCCGCT
  CTGTTTATTGGATGGGCAGGAGCCTCACTGTGCATAATTGGTGGTGTCATATTTTGCTTTTCAATATCTG
  ACAACAACAAAACACCCAGATACACATACAACGGGGCCACATCTGTCATGTCTTCTCGGACAAAGTATCA
  TGGTGGAGAAGATTTTAAAACAACAAACCCTTCAAAACAGTTTGATAAAAATGCTTATGTCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001160100
• ORF Size: 624 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001160100.1, NP_001153572.1
• RefSeq Size: 2601
• RefSeq ORF: 624
• Locus ID: 9071
• Protein Families: Transmembrane
• Protein Pathways: Cell adhesion molecules (CAMs), Leukocyte transendothelial migration, Tight junction
• Gene Summary: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The expression level of this gene is associated with recurrence of primary hepatocellular carcinoma. Six alternatively spliced transcript variants encoding different isoforms have been reported, but the transcript sequences of some variants are not determined. [provided by RefSeq, Jun 2010]
  Transcript Variant: This variant (a_v1) uses an alternate in-frame splice site in the 5' coding region, compared to variant a. The resulting isoform (a_i1) lacks an internal segment near the N-terminus, compared to isoform a.