COX11 (NM_001162862) Human Untagged Clone

CAT#: SC326800

COX11 (untagged)-Human COX11 homolog cytochrome c oxidase assembly protein (yeast) (COX11) nuclear gene encoding mitochondrial protein transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: COX11
• Synonyms: COX11P
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001162862, the custom clone sequence may differ by one or more nucleotides
  ATGGGAGGGCTCTGGCGTCCTGGATGGAGGTGCGTTCCTTTCTGTGGCTGGCGCTGGATC
  CACCCTGGGTCTCCAACCAGGGCTGCAGAGAGGGTAGAGCCGTTTCTTAGGCCAGAGTGG
  AGTGGGACAGGAGGTGCCGAGAGAGGACTGAGGTGGCTTGGGACATGGAAGCGCTGCAGC
  CTTCGAGCCCGGCATCCAGCATTGCAGCCGCCGCGGCGGCCTAAGAGCTCGAACCCTTTC
  ACACGCGCGCAGGAGGAGGAGCGGCGGCGGCAGAACAAGACGACCCTCACTTACGTGGCC
  GCTGTCGCCGTGGGCATGCTGGGGGCGTCCTACGCTGCCGTACCCCTTTATCGGCTCTAT
  TGCCAGACTACTGGACTTGGAGGATCAGCAGTTGCAGGTCATGCCTCAGACAAGATTGAA
  AACATGGTGCCTGTTAAAGATCGAATCATTAAAATTAGCTTTAATGCAGATGTGCATGCA
  AGTCTCCAGTGGAACTTTAGACCTCAGCAAACAGAAATATATGTGGTGCCAGGAGAGACT
  GCACTGGCGTTTTACAGAGCTAAGAATCCTACTGACAAACCAGTAATTGGAATTTCTACA
  TACAATATTGTTCCATTTGAAGCTGGACAGTATTTCAATAAAATACAGGCTTCAAAGCTG
  CACAGAGTCTACGTTTTAGAGAGTTGGCACCTT
  
• Restriction Sites: Please inquire
• ACCN: NM_001162862
• ORF Size: 696 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001162862.1, NP_001156334.1
• RefSeq Size: 824
• RefSeq ORF: 696
• Locus ID: 1353
• Protein Families: Transmembrane
• Protein Pathways: Metabolic pathways, Oxidative phosphorylation
• Gene Summary: Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes a protein which is not a structural subunit, but may be a heme A biosynthetic enzyme involved in COX formation, according to the yeast mutant studies. However, the studies in Rhodobacter sphaeroides suggest that this gene is not required for heme A biosynthesis, but required for stable formation of the Cu(B) and magnesium centers of COX. This human protein is predicted to contain a transmembrane domain localized in the mitochondrial inner membrane. Multiple transcript variants encoding different isoforms have been found for this gene. A related pseudogene has been found on chromosome 6. [provided by RefSeq, Jun 2009]
  Transcript Variant: This variant (3) uses an alternate splice site in the 3' coding region resulting in a frameshift, compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus, compared to isoform 1.