Neuroligin 4 (NLGN4Y) (NM_001164238) Human Untagged Clone

CAT#: SC326827

NLGN4Y (untagged)-Human neuroligin 4 Y-linked (NLGN4Y) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NLGN4Y
• Synonyms: HNL4Y
• Vector: PCMV6-Neo
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001164238, the custom clone sequence may differ by one or more nucleotides
  ATGTTGCGTCCCCAGGGACTGCTATGGCTCCCTTTGTTGTTCACCTCTGTCTGTGTCATG
  TTAAACTCCAATGTTCTTCTGTGGATAACTGCTCTTGCCATCAAGTTCACCCTCATTGAC
  AGCCAAGCACAGTATCCAGTTGTCAACACAAATTATGGTAAAATCCAGGGCCTAAGAACA
  CCATTACCCAGTGAGATCTTGGGTCCAGTGGAGCAGTACTTAGGGGTCCCCTATGCCTCA
  CCCCCAACTGGAGAGAGGCGGTTTCAGCCACCAGAATCCCCATCCTCCTGGACTGGCATC
  CGAAATGCTACTCAGTTTTCTGCTGTGTGCCCCCAGCACCTGGATGAAAGATTCTTATTG
  CATGACATGCTGCCCATCTGGTTTACCACCAGTTTGGATACTTTGATGACCTATGTTCAA
  GATCAAAATGAAGACTGCCTTTACTTAAACATCTATGTGCCCATGGAAGATGGAACCAAC
  ATAAAGAGAAATGCAGACGATATAACCAGTAATGACCATGGTGAAGATAAAGATATTCAT
  GAACAGAACAGTAAGAAGCCTGTTATGGTCTATATCCATGGGGGATCTTACATGGAGGGA
  ACCGGTAACATGATTGATGGCAGCATTTTGGCCAGCTATGGGAACGTCATCGTTATCACC
  ATTAACTACCGTCTGGGAATACTAGGTATGCAAGAGGCACGTTTGTGTGGGAGCTCAAAA
  ATGTTTAATTATTTTAAATCTCCTTTCACTAATTTAATAAATTTTTTT
  
• Restriction Sites: Please inquire
• ACCN: NM_001164238
• ORF Size: 771 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001164238.1, NP_001157710.1
• RefSeq Size: 882
• RefSeq ORF: 771
• Locus ID: 22829
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: This gene encodes a type I membrane protein that belongs to the family of neuroligins, which are cell adhesion molecules present at the postsynaptic side of the synapse, and may be essential for the formation of functional synapses. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2011]
  Transcript Variant: This variant (2) lacks several exons from the 3' end, and contains 2 alternate exons, including the 3' terminal exon, compared to variant 1. This results in a frame-shift, and a shorter isoform (2) with a distinct C-terminus compared to isoform 1.