LYK5 (STRADA) (NM_001165970) Human Untagged Clone
CAT#: SC326867
STRADA (untagged)-Human STE20-related kinase adaptor alpha (STRADA) transcript variant 6
"NM_001165970" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | STRADA |
Synonyms | LYK5; NY-BR-96; PMSE; Stlk; STRAD; STRAD alpha |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001165970, the custom clone sequence may differ by one or more nucleotides
ATGTCATTTCTTGTAAGTAAACCAGAGCGAATCAGGCGGTGGGTCTCGGAAAAGTTCATTGTTGAGGGCT TAAGAGATTTGGAACTATTTGGAGGCAAAGGATTTGAGGACCTGATGACTGTGAATCTAGCAAGGTACAA ACCAACAGGAGAGTACGTGACTGTACGGAGGATTAACCTAGAAGCTTGTTCCAATGAGATGGTAACATTC TTGCAGGGCGAGCTGCATGTCTCCAAACTCTTCAACCATCCCAATATCGTGCCATATCGAGCCACTTTTA TTGCAGACAATGAGCTGTGGGTTGTCACATCATTCATGGCATACGGTTCTGCAAAAGATCTCATCTGTAC ACACTTCATGGATGGCATGAATGAGCTGGCGATTGCTTACATCCTGCAGGGGGTGCTGAAGGCCCTCGAC TACATCCACCACATGGGATATGTACACAGGAGTGTCAAAGCCAGCCACATCCTGATCTCTGTGGATGGGA AGGTCTACCTGTCTGGTTTGCGCAGCAACCTCAGCATGATAAGCCATGGGCAGCGGCAGCGAGTGGTCCA CGATTTTCCCAAGTACAGTGTCAAGGTTCTGCCGTGGCTCAGCCCCGAGGTCCTCCAGCAGAATCTCCAG GGTTATGATGCCAAGTCTGACATCTACAGTGTGGGAATCACAGCCTGTGAACTGGCCAACGGCCATGTCC CCTTTAAGGATATGCCTGCCACCCAGATGCTGCTAGAGAAACTGAACGGCACAGTGCCCTGCCTGTTGGA TACCAGCACCATCCCCGCTGAGGAGCTGACCATGAGCCCTTCGCGCTCAGTGGCCAACTCTGGCCTGAGT GACAGCCTGACCACCAGCACCCCCCGGCCCTCCAACGGCCCAGTGCCAGCACCCTCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001165970 |
ORF Size | 900 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001165970.1, NP_001159442.1 |
RefSeq Size | 2144 |
RefSeq ORF | 900 |
Locus ID | 92335 |
Protein Families | Druggable Genome, Protein Kinase |
Protein Pathways | mTOR signaling pathway |
Gene Summary | The protein encoded by this gene contains a STE20-like kinase domain, but lacks several residues that are critical for catalytic activity, so it is termed a 'pseudokinase'. The protein forms a heterotrimeric complex with serine/threonine kinase 11 (STK11, also known as LKB1) and the scaffolding protein calcium binding protein 39 (CAB39, also known as MO25). The protein activates STK11 leading to the phosphorylation of both proteins and excluding STK11 from the nucleus. The protein is necessary for STK11-induced G1 cell cycle arrest. A mutation in this gene has been shown to result in polyhydramnios, megalencephaly, and symptomatic epilepsy (PMSE) syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described but their full-length nature is not known. [provided by RefSeq, Sep 2009] Transcript Variant: This variant (6) lacks two alternate in-frame exons in the 5' coding region and uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The resulting isoform (6) lacks two internal segments, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228232 | STRADA (Myc-DDK-tagged)-Human STE20-related kinase adaptor alpha (STRADA), transcript variant 6 |
USD 420.00 |
|
RG228232 | STRADA (GFP-tagged) - Human STE20-related kinase adaptor alpha (STRADA), transcript variant 6 |
USD 460.00 |
|
RC228232L3 | Lenti ORF clone of Human STE20-related kinase adaptor alpha (STRADA), transcript variant 6, Myc-DDK-tagged |
USD 620.00 |
|
RC228232L4 | Lenti ORF clone of Human STE20-related kinase adaptor alpha (STRADA), transcript variant 6, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review