LYK5 (STRADA) (NM_001165969) Human Untagged Clone

CAT#: SC326883

STRADA (untagged)-Human STE20-related kinase adaptor alpha (STRADA) transcript variant 5


  "NM_001165969" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "STRADA"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol STRADA
Synonyms LYK5; NY-BR-96; PMSE; Stlk; STRAD; STRAD alpha
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001165969, the custom clone sequence may differ by one or more nucleotides


ATGTCATTTCTTGTAAGTAAACCAGAGCGAATCAGGACCAATGATGCGAGCTCAGAGTCAATAGCATCCT
TCTCTAAACAGGAGGTCATGAGTAGCTTTCTGCCAGAGGGAGGGTGTTACGAGCTGCTCACTGTGATAGG
CAAAGGATTTGAGGACCTGATGACTGTGAATCTAGCAAGGTACAAACCAACAGGAGAGTACGTGACTGTA
CGGAGGATTAACCTAGAAGCTTGTTCCAATGAGATGGTAACATTCTTGCAGGGCGAGCTGCATGTCTCCA
AACTCTTCAACCATCCCAATATCGTGCCATATCGAGCCACTTTTATTGCAGACAATGAGCTGTGGGTTGT
CACATCATTCATGGCATACGGTTCTGCAAAAGATCTCATCTGTACACACTTCATGGATGGCATGAATGAG
CTGGCGATTGCTTACATCCTGCAGGGGGTGCTGAAGGCCCTCGACTACATCCACCACATGGGATATGTAC
ACAGGAGTGTCAAAGCCAGCCACATCCTGATCTCTGTGGATGGGAAGGTCTACCTGTCTGGTTTGCGCAG
CAACCTCAGCATGATAAGCCATGGGCAGCGGCAGCGAGTGGTCCACGATTTTCCCAAGTACAGTGTCAAG
GTTCTGCCGTGGCTCAGCCCCGAGGTCCTCCAGCAGAATCTCCAGGGTTATGATGCCAAGTCTGACATCT
ACAGTGTGGGAATCACAGCCTGTGAACTGGCCAACGGCCATGTCCCCTTTAAGGATATGCCTGCCACCCA
GATGCTGCTAGAGAAACTGAACGGCACAGTGCCCTGCCTGTTGGATACCAGCACCATCCCCGCTGAGGAG
CTGACCATGAGCCCTTCGCGCTCAGTGGCCAACTCTGGCCTGAGTGACAGCCTGACCACCAGCACCCCCC
GGCCCTCCAACGGCCCAGTGCCAGCACCCTCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001165969
ORF Size 945 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001165969.1, NP_001159441.1
RefSeq Size 2189
RefSeq ORF 945
Locus ID 92335
Protein Families Druggable Genome, Protein Kinase
Protein Pathways mTOR signaling pathway
Gene Summary The protein encoded by this gene contains a STE20-like kinase domain, but lacks several residues that are critical for catalytic activity, so it is termed a 'pseudokinase'. The protein forms a heterotrimeric complex with serine/threonine kinase 11 (STK11, also known as LKB1) and the scaffolding protein calcium binding protein 39 (CAB39, also known as MO25). The protein activates STK11 leading to the phosphorylation of both proteins and excluding STK11 from the nucleus. The protein is necessary for STK11-induced G1 cell cycle arrest. A mutation in this gene has been shown to result in polyhydramnios, megalencephaly, and symptomatic epilepsy (PMSE) syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described but their full-length nature is not known. [provided by RefSeq, Sep 2009]
Transcript Variant: This variant (5) lacks two alternate in-frame exons in the 5' coding region and uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The resulting isoform (5) lacks two internal segments, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.