SYTL2 (NM_001162952) Human Untagged Clone

CAT#: SC326902

SYTL2 (untagged)-Human synaptotagmin-like 2 (SYTL2) transcript variant h


  "NM_001162952" in other vectors (4)

Reconstitution Protocol

USD 580.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SYTL2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SYTL2
Synonyms CHR11SYT; EXO4; PPP1R151; SGA72M; SLP2; SLP2A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001162952, the custom clone sequence may differ by one or more nucleotides


ATGAGCAAGTCTGTTCCAGCATTTCTCCAAGATGAGGTGAGTGGCAGTGTGATGAGTGTTTATAGTGGAG
ACTTTGGCAATCTGGAAGTTAAAGGAAATATTCAGTTTGCAATTGAATATGTGGAGTCACTGAAGGAGTT
GCATGTTTTTGTGGCCCAGTGTAAGGACTTAGCAGCAGCGGATGTAAAAAAACAGCGTTCAGACCCATAT
GTAAAGGCCTATTTGCTACCAGACAAAGGCAAAATGGGCAAGAAGAAAACACTCGTAGTGAAGAAAACCT
TGAATCCTGTGTATAACGAAATACTGCGGTATAAAATTGAAAAACAAATCTTAAAGACACAGAAATTGAA
CCTGTCCATTTGGCATCGGGATACATTTAAGCGCAATAGTTTCCTAGGGGAGGTGGAACTTGATTTGGAA
ACATGGGACTGGGATAACAAACAGAATAAACAATTGAGATGGTACCCTCTGAAGCGGAAGACAGCACCAG
TTGCCCTTGAAGCAGAAAACAGAGGTGAAATGAAACTAGCTCTCCAGTATGTCCCAGAGCCAGTCCCTGG
TAAAAAGCTTCCTACAACTGGAGAAGTGCACATCTGGGTGAAGGAATGCCTTGATCTACCACTGCTAAGG
GGAAGTCATCTAAATTCTTTTGTTAAATGTACCATCCTTCCAGATACAAGTAGGAAAAGTCGCCAGAAGA
CAAGAGCTGTAGGGAAAACCACCAACCCTATCTTCAACCACACTATGGTGTATGATGGGTTCAGGCCTGA
AGATCTGATGGAAGCCTGTGTAGAGCTTACTGTCTGGGACCATTACAAATTAACCAACCAATTTTTGGGA
GGTCTTCGTATTGGCTTTGGAACAGGTAAAAGTTATGGGACTGAAGTGGACTGGATGGACTCTACTTCAG
AGGAAGTTGCTCTCTGGGAGAAGATGGTAAACTCCCCCAATACTTGGATTGAAGCAACACTGCCTCTCAG
AATGCTTTTGATTGCCAAGATTTCCAAATGA


Restriction Sites SgfI-MluI     
ACCN NM_001162952
ORF Size 1011 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001162952.2, NP_001156424.1
RefSeq Size 2672
RefSeq ORF 1011
Locus ID 54843
Gene Summary The protein encoded by this gene is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related protein Rab-27A (RAB27A). This protein plays a role in RAB27A-dependent vesicle trafficking and controls melanosome distribution in the cell periphery. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jun 2009]
Transcript Variant: This variant (h) lacks several 5' exons but contains an alternate 5' exon, and it thus differs in its 5' UTR and initiates translation at a downstream in-frame start codon, compared to variant a. The encoded isoform (h) is shorter at the N-terminus, compared to isoform a. Both variants h and l encode isoform h.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.