SYTL2 (NM_001162952) Human Untagged Clone
CAT#: SC326902
SYTL2 (untagged)-Human synaptotagmin-like 2 (SYTL2) transcript variant h
"NM_001162952" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SYTL2 |
Synonyms | CHR11SYT; EXO4; PPP1R151; SGA72M; SLP2; SLP2A |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001162952, the custom clone sequence may differ by one or more nucleotides
ATGAGCAAGTCTGTTCCAGCATTTCTCCAAGATGAGGTGAGTGGCAGTGTGATGAGTGTTTATAGTGGAG ACTTTGGCAATCTGGAAGTTAAAGGAAATATTCAGTTTGCAATTGAATATGTGGAGTCACTGAAGGAGTT GCATGTTTTTGTGGCCCAGTGTAAGGACTTAGCAGCAGCGGATGTAAAAAAACAGCGTTCAGACCCATAT GTAAAGGCCTATTTGCTACCAGACAAAGGCAAAATGGGCAAGAAGAAAACACTCGTAGTGAAGAAAACCT TGAATCCTGTGTATAACGAAATACTGCGGTATAAAATTGAAAAACAAATCTTAAAGACACAGAAATTGAA CCTGTCCATTTGGCATCGGGATACATTTAAGCGCAATAGTTTCCTAGGGGAGGTGGAACTTGATTTGGAA ACATGGGACTGGGATAACAAACAGAATAAACAATTGAGATGGTACCCTCTGAAGCGGAAGACAGCACCAG TTGCCCTTGAAGCAGAAAACAGAGGTGAAATGAAACTAGCTCTCCAGTATGTCCCAGAGCCAGTCCCTGG TAAAAAGCTTCCTACAACTGGAGAAGTGCACATCTGGGTGAAGGAATGCCTTGATCTACCACTGCTAAGG GGAAGTCATCTAAATTCTTTTGTTAAATGTACCATCCTTCCAGATACAAGTAGGAAAAGTCGCCAGAAGA CAAGAGCTGTAGGGAAAACCACCAACCCTATCTTCAACCACACTATGGTGTATGATGGGTTCAGGCCTGA AGATCTGATGGAAGCCTGTGTAGAGCTTACTGTCTGGGACCATTACAAATTAACCAACCAATTTTTGGGA GGTCTTCGTATTGGCTTTGGAACAGGTAAAAGTTATGGGACTGAAGTGGACTGGATGGACTCTACTTCAG AGGAAGTTGCTCTCTGGGAGAAGATGGTAAACTCCCCCAATACTTGGATTGAAGCAACACTGCCTCTCAG AATGCTTTTGATTGCCAAGATTTCCAAATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001162952 |
ORF Size | 1011 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001162952.2, NP_001156424.1 |
RefSeq Size | 2672 |
RefSeq ORF | 1011 |
Locus ID | 54843 |
Gene Summary | The protein encoded by this gene is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related protein Rab-27A (RAB27A). This protein plays a role in RAB27A-dependent vesicle trafficking and controls melanosome distribution in the cell periphery. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jun 2009] Transcript Variant: This variant (h) lacks several 5' exons but contains an alternate 5' exon, and it thus differs in its 5' UTR and initiates translation at a downstream in-frame start codon, compared to variant a. The encoded isoform (h) is shorter at the N-terminus, compared to isoform a. Both variants h and l encode isoform h. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228267 | SYTL2 (Myc-DDK-tagged)-Human synaptotagmin-like 2 (SYTL2), transcript variant h |
USD 420.00 |
|
RG228267 | SYTL2 (GFP-tagged) - Human synaptotagmin-like 2 (SYTL2), transcript variant h |
USD 460.00 |
|
RC228267L3 | Lenti ORF clone of Human synaptotagmin-like 2 (SYTL2), transcript variant h, Myc-DDK-tagged |
USD 620.00 |
|
RC228267L4 | Lenti ORF clone of Human synaptotagmin-like 2 (SYTL2), transcript variant h, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review