CD39 (ENTPD1) (NM_001164181) Human Untagged Clone

CAT#: SC326956

ENTPD1 (untagged)-Human ectonucleoside triphosphate diphosphohydrolase 1 (ENTPD1) transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ENTPD1
• Synonyms: ATPDase; CD39; NTPDase-1; SPG64
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001164181, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAAAGAGCTAGGGAAGTGATTCCAAGGTCCCAGCACCAAGAGACACCCGTTTACCTGGGAGCCACGG
  CAGGCATGCGGTTGCTCAGGATGGAAAGTGAAGAGTTGGCAGACAGGGTTCTGGATGTGGTGGAGAGGAG
  CCTCAGCAACTACCCCTTTGACTTCCAGGGTGCCAGGATCATTACTGGCCAAGAGGAAGGTGCCTATGGC
  TGGATTACTATCAACTATCTGCTGGGCAAATTCAGTCAGAAAACAAGGTGGTTCAGCATAGTCCCATATG
  AAACCAATAATCAGGAAACCTTTGGAGCTTTGGACCTTGGGGGAGCCTCTACACAAGTCACTTTTGTACC
  CCAAAACCAGACTATCGAGTCCCCAGATAATGCTCTGCAATTTCGCCTCTATGGCAAGGACTACAATGTC
  TACACACATAGCTTCTTGTGCTATGGGAAGGATCAGGCACTCTGGCAGAAACTGGCCAAGGACATTCAGG
  TTGCAAGTAATGAAATTCTCAGGGACCCATGCTTTCATCCTGGATATAAGAAGGTAGTGAACGTAAGTGA
  CCTTTACAAGACCCCCTGCACCAAGAGATTTGAGATGACTCTTCCATTCCAGCAGTTTGAAATCCAGGGT
  ATTGGAAACTATCAACAATGCCATCAAAGCATCCTGGAGCTCTTCAACACCAGTTACTGCCCTTACTCCC
  AGTGTGCCTTCAATGGGATTTTCTTGCCACCACTCCAGGGGGATTTTGGGGCATTTTCAGCTTTTTACTT
  TGTGATGAAGTTTTTAAACTTGACATCAGAGAAAGTCTCTCAGGAAAAGGTGACTGAGATGATGAAAAAG
  TTCTGTGCTCAGCCTTGGGAGGAGATAAAAACATCTTACGCTGGAGTAAAGGAGAAGTACCTGAGTGAAT
  ACTGCTTTTCTGGTACCTACATTCTCTCCCTCCTTCTGCAAGGCTATCATTTCACAGCTGATTCCTGGGA
  GCACATCCATTTCATTGGCAAGATCCAGGGCAGCGACGCCGGCTGGACTTTGGGCTACATGCTGAACCTG
  ACCAACATGATCCCAGCTGAGCAACCATTGTCCACACCTCTCTCCCACTCCACCTATGTCTTCCTCATGG
  TTCTATTCTCCCTGGTCCTTTTCACAGTGGCCATCATAGGCTTGCTTATCTTTCACAAGCCTTCATATTT
  CTGGAAAGATATGGTATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001164181
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001164181.1, NP_001157653.1
• RefSeq Size: 12387 bp
• RefSeq ORF: 1209 bp
• Locus ID: 953
• Cytogenetics: 10q24.1
• Protein Families: Transmembrane
• Protein Pathways: Purine metabolism, Pyrimidine metabolism
• Gene Summary: 'The protein encoded by this gene is a plasma membrane protein that hydrolyzes extracellular ATP and ADP to AMP. Inhibition of this protein's activity may confer anticancer benefits. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]'
  Transcript Variant: This variant (5) contains an alternate exon in place of the first exon and lacks an alternate internal exon compared to variant 1, that results in a distinct 5' UTR and translation initiation at a downstream start codon. The encoded isoform (5) has a shorter N-terminus, compared to isoform 1. Both variants 5 and 8 encode the same isoform (5). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.