DAOA (NM_001161814) Human Untagged Clone

CAT#: SC327351

DAOA (untagged)-Human D-amino acid oxidase activator (DAOA) transcript variant 3


  "NM_001161814" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "DAOA"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DAOA
Synonyms LG72; SG72
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001161814, the custom clone sequence may differ by one or more nucleotides
ATGGCACAGAGGCATTTACAGAGATCATTATGTCCTTGGGTCTCTTACCTTCCTCAGCCC
TATGCAGAGCTTGAAGAAGTAAGCAGCCATGTTGGAAAAGTCTTCATGGCAAGAAACTAT
GAGTTCCTTGCCTATGAGGCCTCTAAGGACCGCAGGCAGCCTCTAGAACGAATGTGGACC
TGCAACTACAACCAGCAAAAAGACCAGTCATGCAACCACAAGGAAATAACTTCTACCAAA
GCTGAA
Restriction Sites Please inquire     
ACCN NM_001161814
ORF Size 249 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001161814.1, NP_001155286.1
RefSeq Size 1009
RefSeq ORF 249
Locus ID 267012
Protein Families Druggable Genome
Gene Summary This gene encodes a protein that may function as an activator of D-amino acid oxidase, which degrades the gliotransmitter D-serine, a potent activator of N-methyl-D-aspartate (NMDA) type glutamate receptors. Studies also suggest that one encoded isoform may play a role in mitochondrial function and dendritic arborization. Polymorphisms in this gene have been implicated in susceptibility to schizophrenia and bipolar affective disorder. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Mar 2011]
Transcript Variant: This variant (3) has an alternate 5' exon and an additional segment in the 5' coding region, as compared to variant 1, which results in a downstream AUG start codon. The resulting isoform (3) is shorter and has a different N-terminus, as compared to isoform 1. CCDS Note: This CCDS ID represents the protein described in PMIDs: 12364586 and 14966479. This transcript is supported by AY170469.2. It should be noted this transcript is predicted to undergo nonsense-mediated mRNA decay (NMD). However, the protein is represented because it was detected endogenously in PMID: 18544534. It is likely that the majority of transcripts representing this variant will undergo NMD, while some low level of NMD escape may allow for the expression of this protein. It is likely that the majority of transcripts representing this variant will undergo NMD, while some low level of NMD escape may allow for the expression of this protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.