CIKS (TRAF3IP2) (NM_001164283) Human Untagged Clone
CAT#: SC327359
TRAF3IP2 (untagged)-Human TRAF3 interacting protein 2 (TRAF3IP2) transcript variant 5
"NM_001164283" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TRAF3IP2 |
Synonyms | ACT1; C6orf2; C6orf4; C6orf5; C6orf6; CANDF8; CIKS; PSORS13 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001164283, the custom clone sequence may differ by one or more nucleotides
ATGATAATCGTAGCAATCAGCCCCAAATACAAACAGGACGTGGAAGGCGCTGAGTCGCAG CTGGACGAGGATGAGCATGGCTTACATACTAAGTACATTCATCGAATGATGCAGATTGAG TTCATAAAACAAGGAAGCATGAATTTCAGATTCATCCCTGTGCTCTTCCCAAATGCTAAG AAGGAGCATGTGCCCACCTGGCTTCAGAACACTCATGTCTACAGCTGGCCCAAGAATAAA AAAAACATCCTGCTGCGGCTGCTGAGAGAGGAAGAGTATGTGGCTCCTCCACGGGGGCCT CTGCCCACCCTTCAGGTGGTTCCCTTG |
Restriction Sites | Please inquire |
ACCN | NM_001164283 |
ORF Size | 330 bp |
Insert Size | 4523 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001164283.1, NP_001157755.1 |
RefSeq Size | 4523 |
RefSeq ORF | 330 |
Locus ID | 10758 |
Gene Summary | This gene encodes a protein involved in regulating responses to cytokines by members of the Rel/NF-kappaB transcription factor family. These factors play a central role in innate immunity in response to pathogens, inflammatory signals and stress. This gene product interacts with TRAF proteins (tumor necrosis factor receptor-associated factors) and either I-kappaB kinase or MAP kinase to activate either NF-kappaB or Jun kinase. Several alternative transcripts encoding different isoforms have been identified. Another transcript, which does not encode a protein and is transcribed in the opposite orientation, has been identified. Overexpression of this transcript has been shown to reduce expression of at least one of the protein encoding transcripts, suggesting it has a regulatory role in the expression of this gene. [provided by RefSeq, Aug 2009] Transcript Variant: This variant (5) lacks several exons from the 5' end, and contains an alternate 5' terminal exon compared to variant 2. This results in translation initiation from a downstream AUG, and a shorter isoform (5) compared to isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228724 | TRAF3IP2 (Myc-DDK-tagged)-Human TRAF3 interacting protein 2 (TRAF3IP2), transcript variant 5 |
USD 420.00 |
|
RG228724 | TRAF3IP2 (GFP-tagged) - Human TRAF3 interacting protein 2 (TRAF3IP2), transcript variant 5 |
USD 460.00 |
|
RC228724L3 | Lenti-ORF clone of TRAF3IP2 (Myc-DDK-tagged)-Human TRAF3 interacting protein 2 (TRAF3IP2), transcript variant 5 |
USD 620.00 |
|
RC228724L4 | Lenti-ORF clone of TRAF3IP2 (mGFP-tagged)-Human TRAF3 interacting protein 2 (TRAF3IP2), transcript variant 5 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review