NNT1 (CLCF1) (NM_001166212) Human Untagged Clone

CAT#: SC327400

CLCF1 (untagged)-Human cardiotrophin-like cytokine factor 1 (CLCF1) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CLCF1
• Synonyms: BSF-3; BSF3; CISS2; CLC; NNT-1; NNT1; NR6
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001166212, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTAGCGTGCCTGTGCACGGTGCTCTGGCACCTCCCTGCAGTGCCAGCTCTCAATCGCACAGGGGACC
  CAGGGCCTGGCCCCTCCATCCAGAAAACCTATGACCTCACCCGCTACCTGGAGCACCAACTCCGCAGCTT
  GGCTGGGACCTATCTGAACTACCTGGGCCCCCCTTTCAACGAGCCAGACTTCAACCCTCCCCGCCTGGGG
  GCAGAGACTCTGCCCAGGGCCACTGTTGACTTGGAGGTGTGGCGAAGCCTCAATGACAAACTGCGGCTGA
  CCCAGAACTACGAGGCCTACAGCCACCTTCTGTGTTACTTGCGTGGCCTCAACCGTCAGGCTGCCACTGC
  TGAGCTGCGCCGCAGCCTGGCCCACTTCTGCACCAGCCTCCAGGGCCTGCTGGGCAGCATTGCGGGCGTC
  ATGGCAGCTCTGGGCTACCCACTGCCCCAGCCGCTGCCTGGGACTGAACCCACTTGGACTCCTGGCCCTG
  CCCACAGTGACTTCCTCCAGAAGATGGACGACTTCTGGCTGCTGAAGGAGCTGCAGACCTGGCTGTGGCG
  CTCGGCCAAGGACTTCAACCGGCTCAAGAAGAAGATGCAGCCTCCAGCAGCTGCAGTCACCCTGCACCTG
  GGGGCTCATGGCTTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001166212
• ORF Size: 648 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001166212.1, NP_001159684.1
• RefSeq Size: 1779
• RefSeq ORF: 648
• Locus ID: 23529
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway
• Gene Summary: This gene is a member of the glycoprotein (gp)130 cytokine family and encodes cardiotrophin-like cytokine factor 1 (CLCF1). CLCF1 forms a heterodimer complex with cytokine receptor-like factor 1 (CRLF1). This dimer competes with ciliary neurotrophic factor (CNTF) for binding to the ciliary neurotrophic factor receptor (CNTFR) complex, and activates the Jak-STAT signaling cascade. CLCF1 can be actively secreted from cells by forming a complex with soluble type I CRLF1 or soluble CNTFR. CLCF1 is a potent neurotrophic factor, B-cell stimulatory agent and neuroendocrine modulator of pituitary corticotroph function. Defects in CLCF1 cause cold-induced sweating syndrome 2 (CISS2). This syndrome is characterized by a profuse sweating after exposure to cold as well as congenital physical abnormalities of the head and spine. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Oct 2009]
  Transcript Variant: This variant (2) contains a distinct 5' UTR and lacks an in-frame portion of the 5' coding region, compared to variant 1. The resulting isoform (2) has a shorter N-terminus when compared to isoform 1.