Prolactin (PRL) (NM_001163558) Human Untagged Clone

CAT#: SC327403

PRL (untagged)-Human prolactin (PRL) transcript variant 2


  "NM_001163558" in other vectors (4)

Reconstitution Protocol

USD 540.00

In Stock*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PRL
Synonyms GHA1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_000948 edited
GGGATCCTTATTCTATATCTCTTGGTATTTAGTGTAAAAATTTTAAAATCTTTACCTAGC
AATCTTGAGGAAGAAACTTGATAACTGATAATACATGAGATTGTTACCTAAGTGAAATAT
AATCCTATATATTCAACAAACTTTAGAGAAATAAGATAAATTTTAAAGTAAATGACTTCT
GTAGTTTTATAGATCCTCCAAACCAATCTAGTCTCAGATCTCACCTTCATCATTTCTCTC
ATTTCCTTTTGGCCTAATTAATCAAAATCCTTCCTAGAATGTTCATTTCTGGCCAGTATG
TCTTCCTGAATATGAATAAGAAATAAAATACCATTTGATGTTTGAAATTATGGGGGTAAT
CTCAATGACGGAAATAGATGACCAGGAAAAGGGAAACGAATGCCTGATTCATTATATTCA
TGAAGATATCAAAGGTTTATAAAGCCAATATCTGGGAAAGAGAAAACCGTGAGACTTCCA
GATCTTCTCTGGTGAAGTGTGTTTCCTGCAACGATCACGAACATGAACATCAAAGGATCG
CCATGGAAAGGGTCCCTCCTGCTGCTGCTGGTGTCAAACCTGCTCCTGTGCCAGAGCGTG
GCCCCCTTGCCCATCTGTCCCGGCGGGGCTGCCCGATGCCAGGTGACCCTTCGAGACCTG
TTTGACCGCGCCGTCGTCCTGTCCCACTACATCCATAACCTCTCCTCAGAAATGTTCAGC
GAATTCGATAAACGGTATACCCATGGCCGGGGGTTCATTACCAAGGCCATCAACAGCTGC
CACACTTCTTCCCTTGCCACCCCCGAAGACAAGGAGCAAGCCCAACAGATGAATCAAAAA
GACTTTCTGAGCCTGATAGTCAGCATATTGCGATCCTGGAATGAGCCTCTGTATCATCTG
GTCACGGAAGTACGTGGTATGCAAGAAGCCCCGGAGGCTATCCTATCCAAAGCTGTAGAG
ATTGAGGAGCAAACCAAACGGCTTCTAGAGGGCATGGAGCTGATAGTCAGCCAGGTTCAT
CCTGAAACCAAAGAAAATGAGATCTACCCTGTCTGGTCGGGACTTCCATCCCTGCAGATG
GCTGATGAAGAGTCTCGCCTTTCTGCTTATTATAACCTGCTCCACTGCCTACGCAGGGAT
TCACATAAAATCGACAATTATCTCAAGCTCCTGAAGTGCCGAATCATCCACAACAACAAC
TGCTAAGCCCACATCCATTTCATCTATTTCTGAGAAGGTCCTTAATGATCCGTTCCATTG
CAAGCTTCTTTTAGTTGTATCTCTTTTGAATCCATGCTTGGGTGTAACAGGTCTCCTCTT
AAAAAATAAAAACTGACTCCTTAGAGACATCAAAATCCAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAA
Restriction Sites Please inquire     
ACCN NM_001163558
Insert Size 1400 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001163558.1, NP_001157030.1
RefSeq Size 1027 bp
RefSeq ORF 684 bp
Locus ID 5617
Cytogenetics 6p22.3
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway, Neuroactive ligand-receptor interaction
Gene Summary 'This gene encodes the anterior pituitary hormone prolactin. This secreted hormone is a growth regulator for many tissues, including cells of the immune system. It may also play a role in cell survival by suppressing apoptosis, and it is essential for lactation. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Aug 2011]'
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.