NAT1 (NM_001160171) Human Untagged Clone

CAT#: SC327444

NAT1 (untagged)-Human N-acetyltransferase 1 (arylamine N-acetyltransferase) (NAT1) transcript variant 2


  "NM_001160171" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "NAT1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NAT1
Synonyms AAC1; MNAT; NAT-1; NATI
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001160171, the custom clone sequence may differ by one or more nucleotides
ATGGACATTGAAGCATATCTTGAAAGAATTGGCTATAAGAAGTCTAGGAACAAATTGGAC
TTGGAAACATTAACTGACATTCTTCAACACCAGATCCGAGCTGTTCCCTTTGAGAACCTT
AACATCCATTGTGGGGATGCCATGGACTTAGGCTTAGAGGCCATTTTTGATCAAGTTGTG
AGAAGAAATCGGGGTGGATGGTGTCTCCAGGTCAATCATCTTCTGTACTGGGCTCTGACC
ACTATTGGTTTTGAGACCACGATGTTGGGAGGGTATGTTTACAGCACTCCAGCCAAAAAA
TACAGCACTGGCATGATTCACCTTCTCCTGCAGGTGACCATTGATGGCAGGAACTACATT
GTCGATGCTGGGTTTGGACGCTCATACCAGATGTGGCAGCCTCTGGAGTTAATTTCTGGG
AAGGATCAGCCTCAGGTGCCTTGTGTCTTCCGTTTGACGGAAGAGAATGGATTCTGGTAT
CTAGACCAAATCAGAAGGGAACAGTACATTCCAAATGAAGAATTTCTTCATTCTGATCTC
CTAGAAGACAGCAAATACCGAAAAATCTACTCCTTTACTCTTAAGCCTCGAACAATTGAA
GATTTTGAGTCTATGAATACATACCTGCAGACATCTCCATCATCTGTGTTTACTAGTAAA
TCATTTTGTTCCTTGCAGACCCCAGATGGGGTTCACTGTTTGGTGGGCTTCACCCTCACC
CATAGGAGATTCAATTATAAGGACAATACAGATCTAATAGAGTTCAAGACTCTGAGTGAG
GAAGAAATAGAAAAAGTGCTGAAAAATATATTTAATATTTCCTTGCAGAGAAAGCTTGTG
CCCAAACATGGTGATAGATTTTTTACTATT
Restriction Sites Please inquire     
ACCN NM_001160171
ORF Size 873 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001160171.1, NP_001153643.1
RefSeq Size 2199
RefSeq ORF 873
Locus ID 9
Protein Pathways Caffeine metabolism, Drug metabolism - other enzymes, Metabolic pathways
Gene Summary This gene is one of two arylamine N-acetyltransferase (NAT) genes in the human genome, and is orthologous to the mouse and rat Nat2 genes. The enzyme encoded by this gene catalyzes the transfer of an acetyl group from acetyl-CoA to various arylamine and hydrazine substrates. This enzyme helps metabolize drugs and other xenobiotics, and functions in folate catabolism. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (2, also known as Type IID) lacks an alternate exon in the 5' UTR, compared to variant 1. This variant is transcribed from a promoter known as P1, promoter 2, or NATb promoter. Variants 1-6 and 9 all encode the same isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.