NAT1 (NM_001160174) Human Untagged Clone
CAT#: SC327447
NAT1 (untagged)-Human N-acetyltransferase 1 (arylamine N-acetyltransferase) (NAT1) transcript variant 6
"NM_001160174" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NAT1 |
Synonyms | AAC1; MNAT; NAT-1; NATI |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001160174, the custom clone sequence may differ by one or more nucleotides
ATGGACATTGAAGCATATCTTGAAAGAATTGGCTATAAGAAGTCTAGGAACAAATTGGAC TTGGAAACATTAACTGACATTCTTCAACACCAGATCCGAGCTGTTCCCTTTGAGAACCTT AACATCCATTGTGGGGATGCCATGGACTTAGGCTTAGAGGCCATTTTTGATCAAGTTGTG AGAAGAAATCGGGGTGGATGGTGTCTCCAGGTCAATCATCTTCTGTACTGGGCTCTGACC ACTATTGGTTTTGAGACCACGATGTTGGGAGGGTATGTTTACAGCACTCCAGCCAAAAAA TACAGCACTGGCATGATTCACCTTCTCCTGCAGGTGACCATTGATGGCAGGAACTACATT GTCGATGCTGGGTTTGGACGCTCATACCAGATGTGGCAGCCTCTGGAGTTAATTTCTGGG AAGGATCAGCCTCAGGTGCCTTGTGTCTTCCGTTTGACGGAAGAGAATGGATTCTGGTAT CTAGACCAAATCAGAAGGGAACAGTACATTCCAAATGAAGAATTTCTTCATTCTGATCTC CTAGAAGACAGCAAATACCGAAAAATCTACTCCTTTACTCTTAAGCCTCGAACAATTGAA GATTTTGAGTCTATGAATACATACCTGCAGACATCTCCATCATCTGTGTTTACTAGTAAA TCATTTTGTTCCTTGCAGACCCCAGATGGGGTTCACTGTTTGGTGGGCTTCACCCTCACC CATAGGAGATTCAATTATAAGGACAATACAGATCTAATAGAGTTCAAGACTCTGAGTGAG GAAGAAATAGAAAAAGTGCTGAAAAATATATTTAATATTTCCTTGCAGAGAAAGCTTGTG CCCAAACATGGTGATAGATTTTTTACTATT |
Restriction Sites | Please inquire |
ACCN | NM_001160174 |
ORF Size | 873 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001160174.1, NP_001153646.1 |
RefSeq Size | 2038 |
RefSeq ORF | 873 |
Locus ID | 9 |
Protein Pathways | Caffeine metabolism, Drug metabolism - other enzymes, Metabolic pathways |
Gene Summary | This gene is one of two arylamine N-acetyltransferase (NAT) genes in the human genome, and is orthologous to the mouse and rat Nat2 genes. The enzyme encoded by this gene catalyzes the transfer of an acetyl group from acetyl-CoA to various arylamine and hydrazine substrates. This enzyme helps metabolize drugs and other xenobiotics, and functions in folate catabolism. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (6, also known as Type IIIA) represents use of an alternate promoter and differs in the 5' UTR, compared to variant 1. This variant is transcribed from a promoter immediately upstream of the coding exon known as P4 or promoter 1. Variants 1-6 and 9 all encode the same isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228812 | NAT1 (Myc-DDK-tagged)-Human N-acetyltransferase 1 (arylamine N-acetyltransferase) (NAT1), transcript variant 6 |
USD 420.00 |
|
RG228812 | NAT1 (GFP-tagged) - Human N-acetyltransferase 1 (arylamine N-acetyltransferase) (NAT1), transcript variant 6 |
USD 460.00 |
|
RC228812L3 | Lenti-ORF clone of NAT1 (Myc-DDK-tagged)-Human N-acetyltransferase 1 (arylamine N-acetyltransferase) (NAT1), transcript variant 6 |
USD 620.00 |
|
RC228812L4 | Lenti-ORF clone of NAT1 (mGFP-tagged)-Human N-acetyltransferase 1 (arylamine N-acetyltransferase) (NAT1), transcript variant 6 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review