LENG4 (MBOAT7) (NM_001146082) Human Untagged Clone
CAT#: SC327468
MBOAT7 (untagged)-Human membrane bound O-acyltransferase domain containing 7 (MBOAT7) transcript variant 4
"NM_001146082" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MBOAT7 |
Synonyms | BB1; hMBOA-7; LENG4; LPIAT; LPLAT; LRC4; MBOA7; MRT57; OACT7 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001146082, the custom clone sequence may differ by one or more nucleotides
ATGTCGCCTGAAGAATGGACGTATCTAGTGGTTCTTCTTATCTCCATCCCCATCGGCTTCCTCTTTAAGA AAGCCGGTCCTGGGCTGAAGAGATGGGGAGCAGCCGCTGTGGGCCTGGGGCTCACCCTGTTCACCTGTGG CCCCCACACTTTGCATTCTCTGGTCACCATCCTCGGGACCTGGGCCCTCATTCAGGCCCAGCCCTGCTCC TGCCACGCCCTGGCTCTGGCCTGGACTTTCTCCTATCTCCTGTTCTTCCGAGCCCTCAGCCTCCTGGGCC TGCCCACTCCCACGCCCTTCACCAATGCCGTCCAGCTGCTGCTGACGCTGAAGCTGGTGAGCCTGGCCAG TGAAGTCCAGGACCTGCATCTGGCCCAGAGGAAGGAAATGGCCTCAGGCTTCAGCAAGGGGCCCACCCTG GGGCTGCTGCCCGACGTGCCCTCCCTGATGGAGACACTCAGCTACAGCTACTGCTACGTGGGAATCATGA CAGGCCCGTTCTTCCGCTACCGCACCTACCTGGACTGGCTGGAGCAGCCCTTCCCCGGGGCAGTGCCCAG CCTGCGGCCCCTGCTGCGCCGCGCCTGGCCGGCCCCGCTCTTCGGCCTGCTGTTCCTGCTCTCCTCTCAC CTCTTCCCGCTGGAGGCCGTGCGCGAGGACGCCTTCTACGCCCGCCCGCTGCCCGCCCGCCTCTTCTACA TGATCCCCGTCTTCTTCGCCTTCCGCATGCGCTTCTACGTGGCCTGGATTGCCGCCGAGTGCGGCTGCAT TGCCGCCGGCTTTGGGGCCTACCCCGTGGCCGCCAAAGCCCGGGCCGGAGGCGGCCCCACCCTCCAATGC CCACCCCCCAGCAGTCCGGAGAAGGCGGCTTCCTTGGAGTATGACTATGAGACCATCCGCAACATCGACT GCTACAGCACAGATTTCTGCGTGCGGGTGCGCGATGGCATGCGGTACTGGAACATGACGGTGCAGTGGTG GCTGGCGCAGTATATCTACAAGAGCGCACCTGCCCGTTCCTATGTCCTGCGGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001146082 |
ORF Size | 1035 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001146082.2, NP_001139554.1 |
RefSeq Size | 2085 |
RefSeq ORF | 1035 |
Locus ID | 79143 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a member of the membrane-bound O-acyltransferases family of integral membrane proteins that have acyltransferase activity. The encoded protein is a lysophosphatidylinositol acyltransferase that has specificity for arachidonoyl-CoA as an acyl donor. This protein is involved in the reacylation of phospholipids as part of the phospholipid remodeling pathway known as the Land cycle. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009] Transcript Variant: This variant (4) differs in the 3' UTR and coding region, compared to variant 1. The encoded isoform (3) has a shorter and distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228833 | MBOAT7 (Myc-DDK-tagged)-Human membrane bound O-acyltransferase domain containing 7 (MBOAT7), transcript variant 4 |
USD 420.00 |
|
RG228833 | MBOAT7 (GFP-tagged) - Human membrane bound O-acyltransferase domain containing 7 (MBOAT7), transcript variant 4 |
USD 460.00 |
|
RC228833L1 | Lenti ORF clone of Human membrane bound O-acyltransferase domain containing 7 (MBOAT7), transcript variant 4, Myc-DDK-tagged |
USD 768.00 |
|
RC228833L2 | Lenti ORF clone of Human membrane bound O-acyltransferase domain containing 7 (MBOAT7), transcript variant 4, mGFP tagged |
USD 620.00 |
|
RC228833L3 | Lenti ORF clone of Human membrane bound O-acyltransferase domain containing 7 (MBOAT7), transcript variant 4, Myc-DDK-tagged |
USD 620.00 |
|
RC228833L4 | Lenti ORF clone of Human membrane bound O-acyltransferase domain containing 7 (MBOAT7), transcript variant 4, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review