PRKAR1B (NM_001164760) Human Untagged Clone

CAT#: SC327496

PRKAR1B (untagged)-Human protein kinase cAMP-dependent regulatory type I beta (PRKAR1B) transcript variant 5


  "NM_001164760" in other vectors (4)

Reconstitution Protocol

USD 760.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PRKAR1B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PRKAR1B
Synonyms PRKAR1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001164760, the custom clone sequence may differ by one or more nucleotides
ATGGCCTCCCCGCCCGCCTGCCCCTCGGAGGAGGACGAGAGCCTGAAGGGCTGTGAGCTG
TACGTGCAGCTGCACGGGATCCAGCAGGTCCTCAAAGACTGTATCGTCCACCTCTGCATC
TCCAAGCCCGAACGCCCCATGAAGTTCCTCCGGGAGCACTTCGAGAAGCTGGAGAAGGAA
GAAAACAGGCAGATTTTGGCGCGGCAAAAGTCAAACTCACAGTCGGACTCCCATGATGAG
GAGGTGTCGCCCACCCCCCCGAACCCTGTGGTGAAGGCCCGCCGCCGGCGAGGAGGCGTG
AGTGCCGAGGTGTACACCGAGGAGGACGCCGTGTCCTACGTCAGGAAGGTGATTCCCAAG
GACTACAAAACCATGACTGCGCTGGCCAAGGCCATCTCCAAGAACGTGCTCTTCGCTCAC
CTGGATGACAACGAGAGGAGTGACATATTCGATGCCATGTTCCCTGTCACTCACATCGCT
GGGGAGACTGTTATACAGCAAGGGAATGAAGGAGACAACTTCTATGTCGTTGATCAAGGG
GAAGTGGATGTGTACGTGAACGGAGAGTGGGTGACCAACATCAGCGAGGGAGGCAGCTTC
GGGGAGCTGGCGCTCATCTACGGCACCCCCAGGGCTGCGACCGTGAAAGCCAAGACGGAC
CTCAAGCTCTGGGGGATCGACCGGGACAGCTACCGGCGCATCCTTATGGGCAGCACGCTG
AGGAAACGCAAGATGTACGAGGAGTTCCTCAGCAAGGTCTCCATCCTAGAGTCCCTGGAG
AAGTGGGAGCGTCTGACCGTGGCGGATGCGCTGGAGCCCGTCCAGTTTGAAGATGGAGAG
AAAATTGTGGTCCAGGGAGAGCCTGGGGACGACTTTTACATCATCACGGAGGGCACCGCG
TCCGTGCTGCAGCGCCGGTCCCCCAATGAGGAGTACGTGGAGGTGGGGCGCCTGGGACCC
TCTGACTACTTCGGGGAGATTGCACTGCTGCTGAACCGGCCCCGGGCGGCCACTGTCGTG
GCCCGGGGGCCCCTCAAGTGTGTGAAGCTGGACCGGCCCCGCTTCGAGCGTGTGCTGGGG
CCCTGCTCTGAGATCCTCAAGAGGAACATTCAGCGTTACAACAGCTTCATCTCCCTCACC
GTC
Restriction Sites Please inquire     
ACCN NM_001164760
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001164760.1, NP_001158232.1
RefSeq Size 2533 bp
RefSeq ORF 1146 bp
Locus ID 5575
Cytogenetics 7p22.3
Protein Families Druggable Genome
Protein Pathways Apoptosis, Insulin signaling pathway
Gene Summary 'The protein encoded by this gene is a regulatory subunit of cyclic AMP-dependent protein kinase A (PKA), which is involved in the signaling pathway of the second messenger cAMP. Two regulatory and two catalytic subunits form the PKA holoenzyme, disbands after cAMP binding. The holoenzyme is involved in many cellular events, including ion transport, metabolism, and transcription. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2015]'
Transcript Variant: This variant (5) differs in the 5' UTR compared to variant 1. All of the variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.