RBMXL1 (NM_001162536) Human Untagged Clone

CAT#: SC327505

RBMXL1 (untagged)-Human RNA binding motif protein X-linked-like 1 (RBMXL1) transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RBMXL1
• Synonyms: RBM1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001162536, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTTGAAGCAGATCGCCCAGGAAAGCTCTTCATTGGTGGGCTTAATACGGAAACAAATGAGAAAGCTC
  TTGAAACAGTATTTGGCAAATATGGACGAATAGTGGAAGTACTCTTGATAAAAGACCGTGAAACCAACAA
  ATCAAGAGGATTTGCTTTTGTCACCTTTGAAAGCCCAGCAGACGCTAAGGATGCAGCCAGAGACATGAAT
  GGAAAGTCATTAGATGGAAAAGCCATCAAGGTGGAACAAGCCACCAAACCATCATTTGAAAGAGGTAGAC
  ATGGACCGCCCCCACCTCCAAGAAGTAGAGGTCCTCCAAGAGGTTTTGGAGCTGGAAGAGGAGGAAGTGG
  AGGAACCAGGGGACCTCCTTCACGAGGAGGACACATGGATGATGGTGGATATTCCATGAATTTTAACATG
  AGTTCTTCCAGGGGACCACTCCCAGTAAAAAGAGGACCACCACCAAGAAGTGGGGGTCCTTCTCCTAAGA
  GATCTGCACCTTCAGGACTAGTTCGCAGCAGCAGTGGAATGGGAGGAAGAGCTCCTCTATCACGTGGAAG
  AGATAGTTATGGAGGTCCACCTCGAAGGGAACCGCTCCCCTCTCGTAGAGATGTTTATTTGTCCCCAAGA
  GATGATGGGTATTCTACTAAAGACAGCTATTCAAGCAGAGATTACCCAAGTTCTCGTGATACAAGAGATT
  ATGCACCACCACCACGAGATTATACTTACCGTGATTATGGTCATTCCAGTTCACGTGATGACTATCCATC
  AAGAGGCTATGGCGATAGAGATGGATATGGTCGTGATCGTGACTATTCAGATCATCCAAGTGGAGGTTCC
  TACAGAGATTCATATGAGAGTTATGGTAACTCACGTAGTGCTCCACTTACACGAGGGCCCCCGCCATCTT
  ATGGTGGAAGCAGTCGCTATGATGATTATAGCAGCTCACGTGATGGATATGGTGGAAGTCGAGACAGTTA
  CTCAAGCAGCCGAAGTGATCTCTACTCAAGTTGTGACAGGGTTGGCAGACAAGAAAGAGGGCTTCCCCCT
  TCTGTAGAAAGGGGGTACCCTTCTTCACGTGATTCCTACAGCAGTTCAAGCCGCGGAGCACCAAGAGGTG
  CTGGCCCTGGAGGAAGCCGATCTGATAGAGGGGGAGGCAGAAGCAGATACTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001162536
• ORF Size: 1173 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001162536.2, NP_001156008.1
• RefSeq Size: 5128
• RefSeq ORF: 1173
• Locus ID: 494115
• Gene Summary: This gene represents a retrogene of RNA binding motif protein, X-linked (RBMX), which is located on chromosome X. While all introns in the coding sequence have been processed out compared to the RBMX locus, the ORF is intact and there is specific evidence for transcription at this location. The preservation of the ORF by purifying selection in all Old World monkeys carrying it suggests that this locus is likely to be functional, possibly during male meiosis when X chromosomal genes are silenced or during haploid stages of spermatogenesis. This gene shares 5' exon structure with the cysteine conjugate-beta lyase 2 locus on chromosome 1, but the coding sequences are non-overlapping. Alternative splicing results in two transcript variants. [provided by RefSeq, Jun 2009]
  Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. CCDS Note: This CCDS represents a retrogene of RBMX (RNA binding motif protein, X-linked), which is located on chromosome X. While all introns in the coding sequence have been processed out compared to the RBMX locus, the ORF is intact and there is specific evidence for transcription at this location. Studies in PMID:16201836 indicate that this locus is likely to be functional because the ORF has been preserved by purifying selection in all six Old World primates carrying this retrogene. Given that X chromosomal genes in mammals can generate a statistically significant excess of autosomal retrogenes relative to genes on other chromosomes (PMID:14739461), it is possible that this retrogene may be functional during male meiosis when X chromosomal genes are silenced or during haploid stages of spermatogenesis (PMID:16201836). In addition, it should be noted that this retrogene shares its first non-coding exon with the cysteine conjugate-beta lyase 2 (CCBL2) locus on chromosome 1, but the coding sequences are non-overlapping.