BCKDHA (NM_001164783) Human Untagged Clone
CAT#: SC327535
BCKDHA (untagged)-Human branched chain keto acid dehydrogenase E1 alpha polypeptide (BCKDHA) nuclear gene encoding mitochondrial protein transcript variant 2
"NM_001164783" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | BCKDHA |
Synonyms | BCKDE1A; MSU; MSUD1; OVD1A |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001164783, the custom clone sequence may differ by one or more nucleotides
ATGGCGGTAGCGATCGCTGCAGCGAGGGTCTGGCGGCTAAACCGTGGTTTGAGCCAGGCTGCCCTCCTGC TGCTGCGGCAGCCTGGGGCTCGGGGACTGGCTAGATCTCACCCCCCCAGGCAGCAGCAGCAGTTTTCATC TCTGGATGACAAGCCCCAGTTCCCAGGGGCCTCGGCGGAGTTTATAGATAAGTTGGAATTCATCCAGCCC AACGTCATCTCTGGAATCCCCATCTACCGCGTCATGGACCGGCAAGGCCAGATCATCAACCCCAGCGAGG ACCCCCACCTGCCGAAGGAGAAGGTGCTGAAGCTCTACAAGAGCATGACACTGCTTAACACCATGGACCG CATCCTCTATGAGTCTCAGCGGCAGGGCCGGATCTCCTTCTACATGACCAACTATGGTGAGGAGGGCACG CACGTGGGGAGTGCCGCCGCCCTGGACAACACGGACCTGGTGTTTGGCCAGTACCGGGAGGCAGGTGTGC TGATGTATCGGGACTACCCCCTGGAACTATTCATGGCCCAGTGCTATGGCAACATCAGTGACTTGGGCAA GGGGCGCCAGATGCCTGTCCACTACGGCTGCAAGGAACGCCACTTCGTCACTATCTCCTCTCCACTGGCC ACGCAGATCCCTCAGGCGGTGGGGGCGGCGTACGCAGCCAAGCGGGCCAATGCCAACAGGGTCGTCATCT GTTACTTCGGCGAGGGGGCAGCCAGTGAGGGGGACGCCCATGCCGGCTTCAACTTCGCTGCCACACTTGA GTGCCCCATCATCTTCTTCTGCCGGAACAATGGCTACGCCATCTCCACGCCCACCTCTGAGCAGTATCGC GGCGATGGCATTGCACGAGGCCCCGGGTATGGCATCATGTCAATCCGCGTGGATGGTAATGATGTGTTTG CCGTATACAACGCCACAAAGGAGGCCCGACGGCGGGCTGTGGCAGAGAACCAGCCCTTCCTCATCGAGGC CATGACCTACAGGATCGGGCACCACAGCACCAGTGACGACAGTTCAGCGTACCGCTCGGTGGATGAGGTC AATTACTGGGATAAACAGGACCACCCCATCTCCCGGCTGCGGCACTATCTGCTGAGCCAAGGCTGGTGGG ATGAGGAGCAGGAGAAGGCCTGGAGGAAGCAGTCCCGCAGGAAGGTGATGGAGGCCTTTGAGCAGGCCGA GCGGAAGCCCAAACCCAACCCCAACCTACTCTTCTCAGACGTGTATCAGGAGATGCCCGCCCAGCTCCGC AAGCAGCAGGAGTCTCTGGCCCGCCACCTGCAGACCTACGGGGAGCACTACCCACTGGATCACTTCGATA AGTGA |
Restriction Sites | AscI-MluI |
ACCN | NM_001164783 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001164783.1, NP_001158255.1 |
RefSeq Size | 1788 bp |
RefSeq ORF | 1335 bp |
Locus ID | 593 |
Cytogenetics | 19q13.2 |
Protein Families | Druggable Genome |
Protein Pathways | Metabolic pathways, Valine, leucine and isoleucine degradation |
Gene Summary | 'The branched-chain alpha-keto acid (BCAA) dehydrogenase (BCKD) complex is an innter mitochondrial enzyme complex that catalyzes the second major step in the catabolism of the branched-chain amino acids leucine, isoleucine, and valine. The BCKD complex consists of three catalytic components: a heterotetrameric (alpha2-beta2) branched-chain alpha-keto acid decarboxylase (E1), a dihydrolipoyl transacylase (E2), and a dihydrolipoamide dehydrogenase (E3). This gene encodes the alpha subunit of the decarboxylase (E1) component. Mutations in this gene result in maple syrup urine disease, type IA. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]' Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The resulting isoform (2) lacks one internal amino acid, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228900 | BCKDHA (Myc-DDK-tagged)-Human branched chain keto acid dehydrogenase E1, alpha polypeptide (BCKDHA), nuclear gene encoding mitochondrial protein, transcript variant 2 |
USD 420.00 |
|
RG228900 | BCKDHA (GFP-tagged) - Human branched chain keto acid dehydrogenase E1, alpha polypeptide (BCKDHA), nuclear gene encoding mitochondrial protein, transcript variant 2 |
USD 460.00 |
|
RC228900L3 | Lenti-ORF clone of BCKDHA (Myc-DDK-tagged)-Human branched chain keto acid dehydrogenase E1, alpha polypeptide (BCKDHA), nuclear gene encoding mitochondrial protein, transcript variant 2 |
USD 620.00 |
|
RC228900L4 | Lenti-ORF clone of BCKDHA (mGFP-tagged)-Human branched chain keto acid dehydrogenase E1, alpha polypeptide (BCKDHA), nuclear gene encoding mitochondrial protein, transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review