OAZ3 (NM_016178) Human Untagged Clone

CAT#: SC327764

OAZ3 (untagged)-Human ornithine decarboxylase antizyme 3 (OAZ3) transcript variant 1


  "NM_016178" in other vectors (5)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "OAZ3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol OAZ3
Synonyms AZ3; OAZ-t; TISP15
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_016178, the custom clone sequence may differ by one or more nucleotides


CTGCCTTGTAAGAGGTGTCGCCCCTCTGTCTACTCCCTTTCTTATATCAAGAGGGGAAAAACACGTAACT
ACCTCTACCCGATCTGGTCACCATACGCCTATTACCTTTACTGTTACAAGTACCGGATCACTCTCCGGGA
GAAGATGCTGCCTCGTTGTTATAAAAGCATCACTTATAAGGAAGAGGAGGACTTGACACTCCAGCCCCGT
TCCTGCCTCCAGTGCTCCCTGCCTTGTAAGAGGTGTCGCCCCTCTGTCTACTCCCTTTCTTATATCAAGA
GGGGAAAAACACGTAACTACCTCTACCCGATCTGGTCACCATACGCCTATTACCTTTACTGTTACAAGTA
CCGGATCACTCTCCGGGAGAAGATGCTGCCTCGTTGTTATAAAAGCATCACTTATAAGGAAGAGGAGGAC
TTGACACTCCAGCCCCGTTCCTGCCTCCAGTGCTCC


Restriction Sites SgfI-MluI     
ACCN NM_016178
ORF Size 456 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_016178.2, NP_057262.2
RefSeq Size 901
RefSeq ORF 456
Locus ID 51686
Gene Summary The protein encoded by this gene belongs to the ornithine decarboxylase antizyme family, which plays a role in cell growth and proliferation by regulating intracellular polyamine levels. Expression of antizymes requires +1 ribosomal frameshifting, which is enhanced by high levels of polyamines. Antizymes in turn bind to and inhibit ornithine decarboxylase (ODC), the key enzyme in polyamine biosynthesis; thus, completing the auto-regulatory circuit. This gene encodes antizyme 3, the third member of the antizyme family. Like antizymes 1 and 2, antizyme 3 inhibits ODC activity and polyamine uptake; however, it does not stimulate ODC degradation. Also, while antizymes 1 and 2 have broad tissue distribution, expression of antizyme 3 is restricted to haploid germ cells in testis, suggesting a distinct role for this antizyme in spermiogenesis. Antizyme 3 gene knockout studies showed that homozygous mutant male mice were infertile, and indicated the likely role of this antizyme in the formation of a rigid connection between the sperm head and tail during spermatogenesis. Alternatively spliced transcript variants encoding different isoforms, including one resulting from the use of non-AUG (CUG) translation initiation codon, have been found for this gene. [provided by RefSeq, Dec 2014]
Transcript Variant: This variant (1) initiates translation from a non-AUG (CUG) start codon, and encodes the longest isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.