MYD88 (NM_002468) Human Untagged Clone

CAT#: SC327786

MYD88 (untagged)-Human myeloid differentiation primary response gene (88) (MYD88)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MYD88
• Synonyms: MYD88D
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_002468, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCGACCCGACCGCGCTGAGGCTCCAGGACCGCCCGCCATGGCTGCAGGAGGTCCCGGCGCGGGGTCTG
  CGGCCCCGGTCTCCTCCACATCCTCCCTTCCCCTGGCTGCTCTCAACATGCGAGTGCGGCGCCGCCTGTC
  TCTGTTCTTGAACGTGCGGACACAGGTGGCGGCCGACTGGACCGCGCTGGCGGAGGAGATGGACTTTGAG
  TACTTGGAGATCCGGCAACTGGAGACACAAGCGGACCCCACTGGCAGGCTGCTGGACGCCTGGCAGGGAC
  GCCCTGGCGCCTCTGTAGGCCGACTGCTCGAGCTGCTTACCAAGCTGGGCCGCGACGACGTGCTGCTGGA
  GCTGGGACCCAGCATTGAGGAGGATTGCCAAAAGTATATCTTGAAGCAGCAGCAGGAGGAGGCTGAGAAG
  CCTTTACAGGTGGCCGCTGTAGACAGCAGTGTCCCACGGACAGCAGAGCTGGCGGGCATCACCACACTTG
  ATGACCCCCTGGGGCATATGCCTGAGCGTTTCGATGCCTTCATCTGCTATTGCCCCAGCGACATCCAGTT
  TGTGCAGGAGATGATCCGGCAACTGGAACAGACAAACTATCGACTGAAGTTGTGTGTGTCTGACCGCGAT
  GTCCTGCCTGGCACCTGTGTCTGGTCTATTGCTAGTGAGCTCATCGAAAAGAGGTGCCGCCGGATGGTGG
  TGGTTGTCTCTGATGATTACCTGCAGAGCAAGGAATGTGACTTCCAGACCAAATTTGCACTCAGCCTCTC
  TCCAGGTGCCCATCAGAAGCGACTGATCCCCATCAAGTACAAGGCAATGAAGAAAGAGTTCCCCAGCATC
  CTGAGGTTCATCACTGTCTGCGACTACACCAACCCCTGCACCAAATCTTGGTTCTGGACTCGCCTTGCCA
  AGGCCTTGTCCCTGCCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_002468
• ORF Size: 930 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_002468.4, NP_002459.2
• RefSeq Size: 2862
• RefSeq ORF: 930
• Locus ID: 4615
• Domains: TIR, DEATH
• Protein Families: Druggable Genome
• Protein Pathways: Apoptosis, Toll-like receptor signaling pathway
• Gene Summary: This gene encodes a cytosolic adapter protein that plays a central role in the innate and adaptive immune response. This protein functions as an essential signal transducer in the interleukin-1 and Toll-like receptor signaling pathways. These pathways regulate that activation of numerous proinflammatory genes. The encoded protein consists of an N-terminal death domain and a C-terminal Toll-interleukin1 receptor domain. Patients with defects in this gene have an increased susceptibility to pyogenic bacterial infections. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
  Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1.