MITF (NM_001184968) Human Untagged Clone

CAT#: SC328158

MITF (untagged)-Human microphthalmia-associated transcription factor (MITF) transcript variant 8

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MITF
• Synonyms: bHLHe32; CMM8; COMMAD; MI; WS2; WS2A
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001184968, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTGGAAATGCTAGAATATAATCACTATCAGGTGCAGACCCACCTCGAAAACCCCACCAAGTACCACA
  TACAGCAAGCCCAACGGCAGCAGGTAAAGCAGTACCTTTCTACCACTTTAGCAAATAAACATGCCAACCA
  AGTCCTGAGCTTGCCATGTCCAAACCAGCCTGGCGATCATGTCATGCCACCGGTGCCGGGGAGCAGCGCA
  CCCAACAGCCCCATGGCTATGCTTACGCTTAACTCCAACTGTGAAAAAGAGTTTATGAAGCAGTGA
  
  
• Restriction Sites: Please inquire
• ACCN: NM_001184968
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001184968.1, NP_001171897.1
• RefSeq Size: 1108 bp
• RefSeq ORF: 276 bp
• Locus ID: 4286
• Cytogenetics: 3p13
• Protein Families: Druggable Genome, Transcription Factors
• Protein Pathways: Melanogenesis, Melanoma, Pathways in cancer
• Gene Summary: 'The protein encoded by this gene is a transcription factor that contains both basic helix-loop-helix and leucine zipper structural features. The encoded protein regulates melanocyte development and is responsible for pigment cell-specific transcription of the melanogenesis enzyme genes. Heterozygous mutations in the this gene cause auditory-pigmentary syndromes, such as Waardenburg syndrome type 2 and Tietz syndrome. [provided by RefSeq, Aug 2017]'
  Transcript Variant: This variant (8) has multiple differences, compared to variant 1. These differences result in a distinct 5' UTR and cause translation initiation at an alternate start codon, compared to variant 1. The encoded protein (isoform 8) is shorter than isoform 1 and has unique N- and C-termini.