RIPPLY1 (NM_001171706) Human Untagged Clone

CAT#: SC328170

RIPPLY1 (untagged)-Human ripply1 homolog (zebrafish) (RIPPLY1) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RIPPLY1
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001171706, the custom clone sequence may differ by one or more nucleotides
  ATGGACTCTGCTGCCTGTGCTGCTGCTGCCACCCCTGTTCCAGCCCTGGCTTTGGCCCTA
  GCTCCAGACCTAGCACAAGCCCCACTGGCACTCCCTGGCCTGTTAAGCCCATCTTGCCTT
  CTCTCCTCTGGACAAGAAGTAAATGGGAGTGAAAGGCTCTTCTGGCCTAAATCCCGCTCC
  TTCGACTATCTGTACAGTGCTGGGGAGATTTTACTGCAGAACTTTCCTGTCCAGGCAACC
  ATCAACCTATACGAGGACTCAGACAGCGAAGAAGAAGAGGAAGATGAAGAGCAGGAGGAT
  GAAGAAGAGAAGTAG
  
• Restriction Sites: Please inquire
• ACCN: NM_001171706
• ORF Size: 315 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001171706.1, NP_001165177.1
• RefSeq Size: 1065
• RefSeq ORF: 315
• Locus ID: 92129
• Gene Summary: This gene encodes a protein similar to a zebrafish protein which acts as a transcriptional repressor in and is required for somite segmentation in zebrafish embryos (PMID: 16326386). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
  Transcript Variant: This variant (2) lacks two in-frame exons in the coding region, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.