FNDC5 (NM_001171940) Human Untagged Clone

CAT#: SC328173

FNDC5 (untagged)-Human fibronectin type III domain containing 5 (FNDC5) transcript variant 3


  "NM_001171940" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "FNDC5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FNDC5
Synonyms FRCP2; irisin
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001171940, the custom clone sequence may differ by one or more nucleotides
ATGCTGCGCTTCATCCAGGAGGTGAACACCACCACCCGCTCATGTGCCCTCTGGGACCTG
GAGGAGGATACGGAGTACATAGTCCACGTGCAGGCCATCTCCATTCAGGGCCAGAGCCCA
GCCAGCGAGCCTGTGCTCTTCAAGACCCCGCGTGAGGCTGAGAAGATGGCCTCCAAGAAC
AAAGATGAGGTAACCATGAAAGAGATGGGGAGGAACCAACAGCTGCGGACAGGCGAGGTG
CTGATCATCGTCGTGGTCCTGTTCATGTGGGCAGGTGTCATTGCCCTCTTCTGCCGCCAG
TATGACATCATTGAAGCGTGA
Restriction Sites Please inquire     
ACCN NM_001171940
ORF Size 546 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001171940.1, NP_001165411.2
RefSeq Size 2099
RefSeq ORF 546
Locus ID 252995
Protein Families Transmembrane
Gene Summary This gene encodes a secreted protein that is released from muscle cells during exercise. The encoded protein may participate in the development of brown fat. Translation of the precursor protein initiates at a non-AUG start codon at a position that is conserved as an AUG start codon in other organisms. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
Transcript Variant: This variant (3) contains multiple differences in the UTRs and coding region, compared to variant 1. It initiates translation from an alternate 'AUA' start codon that is conserved as an 'AUG' start codon in orthologs. The encoded isoform (3) is longer and has distinct N- and C-termini, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.