Plasminogen (PLG) (NM_001168338) Human Untagged Clone

CAT#: SC328208

PLG (untagged)-Human plasminogen (PLG) transcript variant 2


  "NM_001168338" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PLG
Synonyms DKFZp779M0222
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001168338, the custom clone sequence may differ by one or more nucleotides
ATGGAACATAAGGAAGTGGTTCTTCTACTTCTTTTATTTCTGAAATCAGGTCAAGGAGAG
CCTCTGGATGACTATGTGAATACCCAGGGGGCTTCACTGTTCAGTGTCACTAAGAAGCAG
CTGGGAGCAGGAAGTATAGAAGAATGTGCAGCAAAATGTGAGGAGGACGAAGAATTCACC
TGCAGGGCATTCCAATATCACAGTAAAGAGCAACAATGTGTGATAATGGCTGAAAACAGG
AAGTCCTCCATAATCATTAGGATGAGAGATGTAGTTTTATTTGAAAAGAAAGTGTATCTC
TCAGAGTGCAAGACTGGGAATGGAAAGAACTACAGAGGGACGATGTCCAAAACAAAAAAT
GGCATCACCTGTCAAAAATGGAGTTCCACTTCTCCCCACAGACCTAGGTAA
Restriction Sites Please inquire     
ACCN NM_001168338
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001168338.1, NP_001161810.1
RefSeq Size 1200 bp
RefSeq ORF 411 bp
Locus ID 5340
Cytogenetics 6q26
Protein Families Druggable Genome, Protease, Secreted Protein
Protein Pathways Complement and coagulation cascades, Neuroactive ligand-receptor interaction
Gene Summary 'The plasminogen protein encoded by this gene is a serine protease that circulates in blood plasma as an inactive zymogen and is converted to the active protease, plasmin, by several plasminogen activators such as tissue plasminogen activator (tPA), urokinase plasminogen activator (uPA), kallikrein, and factor XII (Hageman factor). The conversion of plasminogen to plasmin involves the cleavage of the peptide bond between Arg-561 and Val-562. Plasmin cleavage also releases the angiostatin protein which inhibits angiogenesis. Plasmin degrades many blood plasma proteins, including fibrin-containing blood clots. As a serine protease, plasmin cleaves many products in addition to fibrin such as fibronectin, thrombospondin, laminin, and von Willebrand factor. Plasmin is inactivated by proteins such as alpha-2-macroglobulin and alpha-2-antiplasmin in addition to inhibitors of the various plasminogen activators. Plasminogen also interacts with plasminogen receptors which results in the retention of plasmin on cell surfaces and in plasmin-induced cell signaling. The localization of plasminogen on cell surfaces plays a role in the degradation of extracellular matrices, cell migration, inflamation, wound healing, oncogenesis, metastasis, myogenesis, muscle regeneration, neurite outgrowth, and fibrinolysis. This protein may also play a role in acute respiratory distress syndrome (ARDS) which, in part, is caused by enhanced clot formation and the suppression of fibrinolysis. Compared to other mammals, the cluster of plasminogen-like genes to which this gene belongs has been rearranged in catarrhine primates. [provided by RefSeq, May 2020]'
Transcript Variant: This variant (2) differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (2) is shorter at the C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.