FNDC5 (NM_001171941) Human Untagged Clone
CAT#: SC328236
FNDC5 (untagged)-Human fibronectin type III domain containing 5 (FNDC5) transcript variant 1
"NM_001171941" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | FNDC5 |
Synonyms | FRCP2; irisin |
Vector | PCMV6-Neo |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001171941 edited
ATGCTGCGCTTCATCCAGGAGGTGAACACCACCACCCGCTCATGTGCCCTCTGGGACCTG GAGGAGGATACGGAGTACATAGTCCACGTGCAGGCCATCTCCATTCAGGGCCAGAGCCCA GCCAGCGAGCCTGTGCTCTTCAAGACCCCGCGTGAGGCTGAGAAGATGGCCTCCAAGAAC AAAGATGAGGTAACCATGAAAGAGATGGGGAGGAACCAACAGCTGCGGACAGGCGAGGTG CTGATCATCGTCGTGGTCCTGTTCATGTGGGCAGGTGTCATTGCCCTCTTCTGCCGCCAG TATGACATCATCAAGGACAATGAACCCAATAACAACAAGGAAAAAACCAAGAGTGCATCA GAAACCAGCACACCAGAGCACCAGGGCGGGGGGCTTCTCCGCAGCAAGGTGAGGGCAAGA CCTGGGCCTGGGTGGGCCACCCTGTGCCTCATGCTCTGGTAA |
Restriction Sites | Please inquire |
ACCN | NM_001171941 |
ORF Size | 462 bp |
Insert Size | 500 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001171941.1, NP_001165412.1 |
RefSeq Size | 3035 |
RefSeq ORF | 462 |
Locus ID | 252995 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a secreted protein that is released from muscle cells during exercise. The encoded protein may participate in the development of brown fat. Translation of the precursor protein initiates at a non-AUG start codon at a position that is conserved as an AUG start codon in other organisms. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013] Transcript Variant: This variant (1) represents the longest transcript and encodes the shortest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229598 | FNDC5 (Myc-DDK-tagged)-Human fibronectin type III domain containing 5 (FNDC5), transcript variant 1 |
USD 420.00 |
|
RG229598 | FNDC5 (GFP-tagged) - Human fibronectin type III domain containing 5 (FNDC5), transcript variant 1 |
USD 460.00 |
|
RC229598L3 | Lenti-ORF clone of FNDC5 (Myc-DDK-tagged)-Human fibronectin type III domain containing 5 (FNDC5), transcript variant 1 |
USD 620.00 |
|
RC229598L4 | Lenti-ORF clone of FNDC5 (mGFP-tagged)-Human fibronectin type III domain containing 5 (FNDC5), transcript variant 1 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review