PQBP1 (NM_001167992) Human Untagged Clone

CAT#: SC328255

PQBP1 (untagged)-Human polyglutamine binding protein 1 (PQBP1) transcript variant 10

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PQBP1
• Synonyms: MRX2; MRX55; MRXS3; MRXS8; NPW38; RENS1; SHS
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001167992, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAAC
  CAGAGGAAGAGATCATTGCCGAGGACTATGACGATGATCCTGTGGACTACGAGGCCACCAGGTTGGAGGG
  CCTACCACCAAGCTGGTACAAGGTGTTCGACCCTTCCTGCGGGCTCCCTTACTACTGGAATGCAGACCGG
  GAAGAGGGCAAAGAACGGCGCCACCATCGCCGGGAGGAGCTGGCTCCCTATCCCAAGAGCAAGAAGGCAG
  TAAGCCGAAAGGATGAAGAGTTAGACCCCATGGACCCTAGCTCATACTCAGACGCCCCCCGGGGCACGTG
  GTCAACAGGACTCCCCAAGCGGAATGAGGCCAAGACTGGCGCTGACACCACAGCAGCTGGGCCCCTCTTC
  CAGCAGCGGCCGTATCCATCCCCAGGGGCTGTGCTCCGGGCCAATGCAGAGGCCTCCCGAACCAAGCAGC
  AGGATTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001167992
• ORF Size: 498 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001167992.1, NP_001161464.1
• RefSeq Size: 611
• RefSeq ORF: 498
• Locus ID: 10084
• Protein Families: Transcription Factors
• Protein Pathways: Spliceosome
• Gene Summary: This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked cognitive disability. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
  Transcript Variant: This variant (10) lacks a 5' UTR and uses different splice sites in the coding region, compared to variant 1. The resulting protein (isoform 6) is shorter when it is compared to isoform 1.