PNPLA4 (NM_001172672) Human Untagged Clone

CAT#: SC328259

PNPLA4 (untagged)-Human patatin-like phospholipase domain containing 4 (PNPLA4) transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PNPLA4
• Synonyms: DXS1283E; GS2; iPLA2eta
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001172672, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCCGACTAAGAAGTGGGATGGAGTCGATTCTTCCTCCCAGCGCTCACGAGCTGGCCCAGAACCGAC
  TGCACGTATCCATCACCAACGCCAAAACCAGAGAAAATCACTTAGTCTCCACTTTTTCCTCCAGGGAGGA
  CCTCATTAAGGTCCTCCTAGCCAGCAGTTTTGTGCCCATTTATGCAGGACTGAAGCTAGTGGAATACAAA
  GGGCAGAAGTGGGTGGACGGAGGCCTCACCAACGCTCTTCCCATCCTGCCCGTCGGCCGGACAGTAACCA
  TCTCCCCCTTCAGTGGACGACTGGACATCTCCCCGCAGGACAAAGGGCAGCTAGATCTGTATGTTAATAT
  CGCCAAGCAGGATATCATGTTGTCCCTGGCAAACCTGGTGAGACTCAACCAAGCCCTTTTTCCCCCAAGC
  AAGAGGAAAATGGAATCTTTGTATCAGTGTGGTTTTGATGACACTGTTAAGTTTTTACTTAAAGAAAATT
  GGTTTGAATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001172672
• ORF Size: 501 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001172672.1, NP_001166143.1
• RefSeq Size: 2559
• RefSeq ORF: 501
• Locus ID: 8228
• Protein Pathways: Retinol metabolism
• Gene Summary: This gene encodes a member of the patatin-like family of phospholipases. The encoded enzyme has both triacylglycerol lipase and transacylase activities and may be involved in adipocyte triglyceride homeostasis. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome Y. [provided by RefSeq, Feb 2010]
  Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.