C9orf25 (FAM219A) (NM_001184942) Human Untagged Clone

CAT#: SC328273

FAM219A (untagged)-Human chromosome 9 open reading frame 25 (C9orf25) transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FAM219A
• Synonyms: C9orf25
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001184942, the custom clone sequence may differ by one or more nucleotides
  ATGATGGAGGAGATCGACCGGTTCCAGGACCCAGCCGCCGCCTCCATCTCTGACGGAGAC
  TGTGACGCCCGGGAGGGTGAGTCAGTAGCCATGAATTACAAACCATCCCCGCTCCAAGTG
  AAGCTGGAGAAGCAGCGGGAGCTGGCCCGGAAGGGCTCCCTGAAGAATGGCAGCATGGGT
  AGCCCTGTCAACCAGCAACCCAAGAAGAACAATGTCATGGCCCGAACAAGGCTGGTCGTC
  CCCAATAAAGGCTACTCCTCACTTGACCAGAGCCCTGATGAGAAGCCACTGGTAGCCCTT
  GACACGGACAGCGATGATGACTTTGACATGTCTAGATACTCCTCCTCCGGCTACTCCTCT
  GCTGAGATCAACCAAGATTTGAACATCCAGCTGCTGAAGGACGGCTACCGGTTAGATGAG
  ATCCCCGACGACGAGGACCTAGACCTCATCCCCCCCAAGTCCGTGAACCCCACGTGCATG
  TGCTGCCAGGCCACGTCCTCCACCGCCTGCCACATTCAGTAG
  
• Restriction Sites: Please inquire
• ACCN: NM_001184942
• ORF Size: 522 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001184942.1, NP_001171871.1
• RefSeq Size: 3656
• RefSeq ORF: 522
• Locus ID: 203259
• Gene Summary: The protein encoded by this gene has homologs that have been identified in mouse, macaque, etc organisms. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Dec 2010]
  Transcript Variant: This variant (3) uses two different splice sites in the coding region, compared to variant 1. The resulting protein (isoform 3) is shorter when it is compared to isoform 1.