VIT (NM_001177972) Human Untagged Clone

CAT#: SC328319

VIT (untagged)-Human vitrin (VIT) transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: VIT
• Synonyms: VIT1
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001177972, the custom clone sequence may differ by one or more nucleotides
  ATGAGGACTGTTGTTCTCACTATGAAGGCATCTGTTATTGAAATGTTCCTTGTTTTGCTG
  GTGACTGGAGTACATTCAAACAAAGAAACGGCAAAGAAGATTAAAAGGCCCAAGTTCACT
  GTGCCTCAGATCAACTGCGATGTCAAAGCCGGAAAGATCATCGATCCTGAGTTCATTGTG
  AAATGTCCAGCAGGATGCCAAGACCCCAAATACCATGTTTATGGCACTGACGTGTATGCA
  TCCTACTCCAGTGTGTGTGGCGCTGCCGTACACAGTGGTGTGCTTGATAATTCAGGAGGG
  AAAATACTTGTTCGGAAGGTTGCTGGACAGTCTGGTTACAAAGGGAGTTATTCCAACGGT
  GTCCAATCGTTATCCCTACCACGATGGAGAGAATCCTTTATCGTCTTAGAAAGTAAACCC
  AAAAAGGGTGTAACCTACCCATCAGCTCTTACATACTCATCATCGAAAAGTCCAGCTGCC
  CAAGCAGGCAAGTGCTCACGTGTGATTGAATCTAAACCTTCTGAGTCCATGAACACGCGA
  CGTGTTTTGGGAGATAGCGGAGAAATTAACATCTTAACCGGTCAAGCTCCACTGGCTCTG
  GCAATATTTTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_001177972
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001177972.1, NP_001171443.1
• RefSeq Size: 1433 bp
• RefSeq ORF: 612 bp
• Locus ID: 5212
• Cytogenetics: 2p22.2
• Protein Families: Secreted Protein
• Gene Summary: 'This gene encodes an extracellular matrix (ECM) protein. The protein may be associated with cell adhesion and migration. High levels of expression of the protein in specific parts of the brain suggest its likely role in neural development. [provided by RefSeq, Jun 2016]'
  Transcript Variant: This variant (5) contains an alternate segment at its 3' end compared to variant 1. The resulting protein (isoform 5) is shorter and has a distinct C-terminus compared to isoform 1.