Claudin 7 (CLDN7) (NM_001185022) Human Untagged Clone

CAT#: SC328329

CLDN7 (untagged)-Human claudin 7 (CLDN7) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CLDN7
• Synonyms: CEPTRL2; claudin-1; CLDN-7; CPETRL2; Hs.84359
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001185022, the custom clone sequence may differ by one or more nucleotides
  ATGGCCAATTCGGGCCTGCAGTTGCTGGGCTTCTCCATGGCCCTGCTGGGCTGGGTGGGT
  CTGGTGGCCTGCACCGCCATCCCGCAGTGGCAGATGAGCTCCTATGCGGGTGACAACATC
  ATCACGGCCCAGGCCATGTACAAGGGGCTGTGGATGGACTGCGTCACGCAGAGCACGGGG
  ATGATGAGCTGCAAAATGTACGACTCGGTGCTCGCCCTGTCCGCGGCCTTGCAGGCCACT
  CGAGCCCTAATGGTGGTCTCCCTGGTGCTGGGCTTCCTGGCCATGTTTGTGGCCACGATG
  GGCATGAAGTGCACGCGCTGTGGGGGAGACGACAAAGTGAAGAAGGCCCGTATAGCCATG
  GGTGGAGGCATAATTTTCATCGTGGCAGGTCTTGCCGCCTTGGTAGCTTGCTCCTGGTAT
  GGCCATCAGATTGTCACAGACTTTTATAACCCTTTGATCCCTACCAACATTAAGTATGAG
  TTTGGCCCTGCCATCTTTATTGGCTGGGCAGGGTCTGCCCTAGTCATCCTGGGAGGTGCA
  CTGCTCTCCTGTTCCTGTCCTGGGAATGAGAGCAAGGCTGGGTACCGTGTACCCCGCTCT
  TACCCTAAGTCCAACTCTTCCAAGGAGTATGTGTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001185022
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001185022.1, NP_001171951.1
• RefSeq Size: 1462 bp
• RefSeq ORF: 636 bp
• Locus ID: 1366
• Cytogenetics: 17p13.1
• Protein Families: Transmembrane
• Protein Pathways: Cell adhesion molecules (CAMs), Leukocyte transendothelial migration, Tight junction
• Gene Summary: 'This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. Differential expression of this gene has been observed in different types of malignancies, including breast cancer, ovarian cancer, hepatocellular carcinomas, urinary tumors, prostate cancer, lung cancer, head and neck cancers, thyroid carcinomas, etc.. Alternatively spliced transcript variants encoding different isoforms have been found.[provided by RefSeq, May 2010]'
  Transcript Variant: This variant (2) has an alternate 5' UTR sequence, as compared to variant 1. Variants 1 and 2 encode the same isoform (1).