TIMM17B (NM_001167947) Human Untagged Clone

CAT#: SC328354

TIMM17B (untagged)-Human translocase of inner mitochondrial membrane 17 homolog B (yeast) (TIMM17B) nuclear gene encoding mitochondrial protein transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TIMM17B
• Synonyms: DXS9822; JM3; TIM17B
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001167947, the custom clone sequence may differ by one or more nucleotides
  ATGGAGGAGTACGCTCGGGAGCCCTGCCCATGGCGAATTGTGGATGATTGCGGTGGAGCC
  TTCACTATGGGTGTCATCGGTGGCGGAGTCTTCCAGGCCATCAAGGGTTTCCGCAATGCC
  CCTGTTTGCAGATTGCTGTCTGAAGCTCCCTTGTTTATCTACTCTTGCTCAAGATCTGTG
  TCTCCCACCGTTAATGTGAGCTCTGAGAGGGCAGAGAGCAGACCTACCTTGTTCATGGCT
  GTATCCCTGCATATGGCATGGTGCTTGGCACATATAGGAATTCGGCACCGGTTGAGAGGT
  AGTGCCAATGCTGTGAGGATCCGAGCCCCCCAGATTGGAGGTAGCTTCGCAGTGTGGGGG
  GGCCTGTTCTCCACCATTGACTGTGGCCTGGTGCGGCTTCGGGGCAAGGAGGATCCCTGG
  AACTCTATCACCAGTGGAGCATTGACCGGGGCTGTGCTGGCTGCCCGCAGTGGCCCACTG
  GCCATGGTGGGCTCAGCAATGATGGGGGGCATCCTGTTGGCCCTCATTGAGGGCGTTGGC
  ATCCTCCTCACTCGCTACACAGCCCAGCAGTTCCGAAATGCGCCCCCATTCCTGGAGGAC
  CCCAGCCAGCTGCCCCCTAAGGATGGCACCCCGGCCCCAGGCTACCCCAGCTATCAGCAG
  TACCACTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001167947
• ORF Size: 669 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001167947.1, NP_001161419.1
• RefSeq Size: 1117
• RefSeq ORF: 669
• Locus ID: 10245
• Protein Families: Transmembrane
• Gene Summary: This gene encodes a multipass transmembrane protein that forms an integral component of the mitochondrial translocase TIM23 complex. This complex facilitates the transport of mitochondrial proteins from the cytosol across the mitochondrial inner membrane and into the mitochondrion. There is a pseudogene for this gene on chromosome 12. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1, also known as hTim17a).