C2orf28 (ATRAID) (NM_001170795) Human Untagged Clone

CAT#: SC328361

ATRAID (untagged)-Human chromosome 2 open reading frame 28 (C2orf28) transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ATRAID
• Synonyms: APR--3; APR-3; APR3; C2orf28; HSPC013; p18; PRO240
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001170795, the custom clone sequence may differ by one or more nucleotides
  ATGGCGCCTCACGACCCGGGTAGTCTTACGACCCTGGTGCCCTGGGCTGCCGCCCTGCTC
  CTCGCTCTGGGCGTGGAAAGGGCTCTGGCGCTACCCGAGATATGCACCCAATGTCCAGGG
  AGCGTGCAAAATTTGTCAAAAGTGGCCTTTTATTGTAAAACGACACGAGAGCTAATGCTG
  CATGCCCGTTGCTGCCTGAATCAGAAGGGCACCATCTTGGGGCTGGATCTCCAGAACTGT
  TCTCTGGAGGACCCTGGTCCAAACTTTCATCAGGCACATACCACTGTCATCATAGACCTG
  CAAGCAAACCCCCTCAAAGGTGACTTGGCCAACACCTTCCGTGGCTTTACTCAGCTCCAG
  ACTCTGATACTGCCACAACATGTCAACTGTCCTGGAGGAATTAATGCCTGGAATACTATC
  ACCTCTTATATAGACAACCAAATCTGTCAAGGGCAAAAGAACCTTTGCAATAACACTGGG
  GACCCAGAAATGTGTCCTGAGAATGGATCTTGTGTACCTGATGGTCCAGGTCTTTTGCAG
  TGTGTTTGTGCTGATGGTTTCCATGGATACAAGTGTATGCGCCAGGGCTCGTTCTCACTG
  CTTATGTTCTTCGGGATTCTGGGAGCCACCACTCTATCCGTCTCCATTCTGCTTTGGGCG
  ACCCAGCGCCGAAAAGCCAAGACTTCATGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001170795
• ORF Size: 690 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001170795.1, NP_001164266.1
• RefSeq Size: 958
• RefSeq ORF: 690
• Locus ID: 51374
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: This gene is thought to be involved in apoptosis, and may also be involved in hematopoietic development and differentiation. The use of alternative splice sites and promotors result in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2009]
  Transcript Variant: This variant (3) starts from an alternate promoter, compared to variant 2. This difference cause translation initiation from a downstream in-frame AUG and an isoform (c) with a shorter N-terminus compared to isoform b. This isoform contains a signal peptide domain that is not present in isoform a or b and is likely a secreted protein.