CLM 9 (CD300LG) (NM_001168324) Human Untagged Clone

CAT#: SC328371

CD300LG (untagged)-Human CD300 molecule-like family member g (CD300LG) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CD300LG
• Synonyms: CLM-9; CLM9; NEPMUCIN; TREM-4; TREM4
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001168324, the custom clone sequence may differ by one or more nucleotides
  ATGCGGCTTCTGGTCCTGCTATGGGGTTGCCTGCTGCTCCCAGGTTATGAAGCCCTGGAG
  GGCCCAGAGGAAATCAGCGGGTTCGAAGGGGACACTGTGTCCCTGCAGTGCACCTACAGG
  GAAGAGCTGAGGGACCACCGGAAGTACTGGTGCAGGAAGGGTGGGATCCTCTTCTCTCGC
  TGCTCTGGCACCATCTATGCAGAAGAAGAAGGCCAGGAGACAATGAAGGGCAGGGTGTCC
  ATCCGTGACAGCCGCCAGGAGCTCTCGCTCATTGTGACCCTGTGGAACCTCACCCTGCAA
  GACGCTGGGGAGTACTGGTGTGGGGTCGAAAAACGGGGCCCCGATGAGTCTTTACTGATC
  TCTCTGTTCGTCTTTCCAGGGAGCTCCCGCCCCCCCATGCAGCTGGACTCCACCTCAGCA
  GAGGACACCAGTCCAGCTCTCAGCAGTGGCAGCTCTAAGCCCAGGGTGTCCATCCCGATG
  GTCCGCATACTGGCCCCAGTCCTGGTGCTGCTGAGCCTTCTGTCAGCCGCAGGCCTGATC
  GCCTTCTGCAGCCACCTGCTCCTGTGGAGAAAGGAAGCTCAACAGGCCACGGAGACACAG
  AGGAACGAGAAGTTCTGCCTCTCACGCTTGAATCACAGAACATCAGAGCTGGATCCAGAT
  GAAGCCTTTGAGATCTCTAGCCTGACTTTTCTCTCAGTTTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001168324
• ORF Size: 702 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001168324.1, NP_001161796.1
• RefSeq Size: 996
• RefSeq ORF: 702
• Locus ID: 146894
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: Members of the CD300 (see MIM 606786)-like (CD300L) family, such as CD300LG, are widely expressed on hematopoietic cells. All CD300L proteins are type I cell surface glycoproteins that contain a single immunoglobulin (Ig) V-like domain (Takatsu et al., 2006 [PubMed 16876123]). [supplied by OMIM, Mar 2008]
  Transcript Variant: This variant (2) has multiple differences in the coding region, compared to variant 1, one of which results in a translational frameshift. The resulting protein (isoform 2) has a distinct C-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.