Thymidine Kinase 2 (TK2) (NM_001172643) Human Untagged Clone

CAT#: SC328373

TK2 (untagged)-Human thymidine kinase 2 mitochondrial (TK2) transcript variant 2


  "NM_001172643" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TK2
Synonyms MTDPS2; MTTK; PEOB3; SCA31
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001172643, the custom clone sequence may differ by one or more nucleotides
ATGGGTGCGTTCTGCCAGCGTCCTAGCAGTGATAAAGAACAGGAAAAAGAGAAAAAATCA
GTGATCTGTGTCGAGGGCAATATTGCAAGTGGGAAGACGACATGCCTGGAATTCTTCTCC
AACGCGACAGACGTCGAGGTGTTAACGGAGCCTGTGTCCAAGTGGAGAAATGTCCGTGGC
CACAATCCTCTGGGCCTGATGTACCACGATGCCTCTCGCTGGGGTCTTACGCTACAGACT
TATGTGCAGCTCACCATGCTGGACAGGCATACTCGTCCTCAGGTGTCATCTGTACGGTTG
ATGGAGAGGTCGATTCACAGCGCAAGATACATTTTTGTAGAAAACCTGTATAGAAGTGGG
AAGATGCCAGAAGTGGACTATGTAGTTCTGTCGGAATGGTTTGACTGGATCTTGAGGAAC
ATGGACGTGTCTGTTGATTTGATAGTTTACCTTCGGACCAATCCTGAGACTTGTTACCAG
AGGTTAAAGAAGAGATGCAGGGAAGAGGAGAAGGTCATTCCGCTGGAATACCTGGAAGCA
ATTCACCATCTCCATGAGGAGTGGCTCATCAAAGGCAGCCTTTTCCCCATGGCAGCCCCT
GTTCTGGTGATTGAGGCTGACCACCACATGGAGAGGATGTTAGAACTCTTTGAACAAAAT
CGGGATCGAATATTAACTCCAGAGAATCGGAAGCATTGCCCATAG
Restriction Sites Please inquire     
ACCN NM_001172643
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001172643.1, NP_001166114.1
RefSeq Size 4678 bp
RefSeq ORF 705 bp
Locus ID 7084
Cytogenetics 16q21
Protein Families Druggable Genome
Protein Pathways Drug metabolism - other enzymes, Metabolic pathways, Pyrimidine metabolism
Gene Summary 'This gene encodes a deoxyribonucleoside kinase that specifically phosphorylates thymidine, deoxycytidine, and deoxyuridine. The encoded enzyme localizes to the mitochondria and is required for mitochondrial DNA synthesis. Mutations in this gene are associated with a myopathic form of mitochondrial DNA depletion syndrome. Alternate splicing results in multiple transcript variants encoding distinct isoforms, some of which lack transit peptide, so are not localized to mitochondria. [provided by RefSeq, Dec 2012]'
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) is not localized to mitochondria, and it has a distinct N-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.