Tissue Factor (F3) (NM_001178096) Human Untagged Clone
CAT#: SC328381
F3 (untagged)-Human coagulation factor III (thromboplastin tissue factor) (F3) transcript variant 2
"NM_001178096" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | F3 |
Synonyms | CD142; TF; TFA |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001178096 edited
ATGGAGACCCCTGCCTGGCCCCGGGTCCCGCGCCCCGAGACCGCCGTCGCTCGGACGCTC CTGCTCGGCTGGGTCTTCGCCCAGGTGGCCGGCGCTTCAGGCACTACAAATACTGTGGCA GCATATAATTTAACTTGGAAATCAACTAATTTCAAGACAATTTTGGAGTGGGAACCCAAA CCCGTCAATCAAGTCTACACTGTTCAAATAAGCACTAAGTCAGGAGATTGGAAAAGCAAA TGCTTTTACACAACAGACACAGAGTGTGACCTCACCGACGAGATTGTGAAGGATGTGAAG CAGACGTACTTGGCACGGGTCTTCTCCTACCCGGCAGGGAATGTGGAGAGCACCGGTTCT GCTGGGGAGCCTCTGTATGAGAACTCCCCAGAGTTCACACCTTACCTGGAGACAAACCTC GGACAGCCAACAATTCAGAGTTTTGAACAGGTGGGAACAAAAGTGAATGTGACCGTAGAA GATGAACGGACTTTAGTCAGAAGGAACAACACTTTCCTAAGCCTCCGGGATGTTTTTGGC AAGGACTTAATTTATACACTTTATTATTGGAAATCTTCAAGTTCAGGAAAGAAAATTCTA CATCATTGGAGCTGTGGTATTTGTGGTCATCATCCTTGTCATCATCCTGGCTATATCTCT ACACAAGTGTAGAAAGGCAGGAGTGGGGCAGAGCTGGAAGGAGAACTCCCCACTGA |
Restriction Sites | Please inquire |
ACCN | NM_001178096 |
Insert Size | 2100 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001178096.1, NP_001171567.1 |
RefSeq Size | 2233 bp |
RefSeq ORF | 717 bp |
Locus ID | 2152 |
Cytogenetics | 1p21.3 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Complement and coagulation cascades |
Gene Summary | 'This gene encodes coagulation factor III which is a cell surface glycoprotein. This factor enables cells to initiate the blood coagulation cascades, and it functions as the high-affinity receptor for the coagulation factor VII. The resulting complex provides a catalytic event that is responsible for initiation of the coagulation protease cascades by specific limited proteolysis. Unlike the other cofactors of these protease cascades, which circulate as nonfunctional precursors, this factor is a potent initiator that is fully functional when expressed on cell surfaces, for example, on monocytes. There are 3 distinct domains of this factor: extracellular, transmembrane, and cytoplasmic. Platelets and monocytes have been shown to express this coagulation factor under procoagulatory and proinflammatory stimuli, and a major role in HIV-associated coagulopathy has been described. Platelet-dependent monocyte expression of coagulation factor III has been described to be associated with Coronavirus Disease 2019 (COVID-19) severity and mortality. This protein is the only one in the coagulation pathway for which a congenital deficiency has not been described. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Aug 2020]' Transcript Variant: This variant (2) lacks an exon in the coding region, which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229743 | F3 (Myc-DDK-tagged)-Human coagulation factor III (thromboplastin, tissue factor) (F3), transcript variant 2 |
USD 420.00 |
|
RG229743 | F3 (GFP-tagged) - Human coagulation factor III (thromboplastin, tissue factor) (F3), transcript variant 2 |
USD 460.00 |
|
RC229743L3 | Lenti-ORF clone of F3 (Myc-DDK-tagged)-Human coagulation factor III (thromboplastin, tissue factor) (F3), transcript variant 2 |
USD 620.00 |
|
RC229743L4 | Lenti-ORF clone of F3 (mGFP-tagged)-Human coagulation factor III (thromboplastin, tissue factor) (F3), transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review