Glycogenin 2 (GYG2) (NM_001184704) Human Untagged Clone
CAT#: SC328393
GYG2 (untagged)-Human glycogenin 2 (GYG2) transcript variant 5
"NM_001184704" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GYG2 |
Synonyms | GN-2; GN2 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001184704, the custom clone sequence may differ by one or more nucleotides
ATGGAACACGGCAGCTTTGACGGGGCAGACCAAGGCTTACTGAATAGTTTCTTCAGGAAC TGGTCGACCACAGACATCCACAAGCACCTGCCGTTCATCTATAACTTGAGTAGTAACACG ATGTACACTTACAGCCCTGCCTTCAAGCAATTCGGTTCCAGTGCAAAGGTCGTCCACTTT TTGGGGTCCATGAAACCTTGGAACTACAAGTACAATCCACAGAGTGGCTCGGTGTTGGAG CAAGGCTCAGCGTCCAGCAGCCAGCACCAGGCGGCATTCCTTCATCTCTGGTGGACGGTC TACCAGAACAACGTGCTGCCCCTTTATAAAAGCGTCCAAGCGGGGGAAGCACGCGCGTCT CCTGGTCACACACTTTGCCACAGTGATGTGGGGGGGCCGTGTGCGGATTCAGCCTCTGGT GTTGGAGAGCCGTGTGAAAATTCAACACCCAGTGCGGGCGTGCCGTGTGCAAATTCACCA CTGGGTTCTAACCAGCCTGCTCAGGGCCTTCCGGAGCCGACCCAGATAGTGGATGAGACC CTGTCCCTACCTGAAGGACGCCGTTCAGAAGATGTCGACCTGGCCGTCTCTGTTTCCCAG ATCTCCATCGAAGAGAAGGTGAAGGAATTGAGCCCCGAGGAAGAGAGGAGGAAGTGGGAG GAAGGCCGTATCGACTACATGGGGAAGGACGCGTTTGCTCGCATCCAGGAGAAGCTGGAC CGGTTCCTGCAGTAA |
Restriction Sites | Please inquire |
ACCN | NM_001184704 |
ORF Size | 735 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001184704.1, NP_001171633.1 |
RefSeq Size | 2947 |
RefSeq ORF | 735 |
Locus ID | 8908 |
Gene Summary | This gene encodes a member of the the glycogenin family. Glycogenin is a self-glucosylating protein involved in the initiation reactions of glycogen biosynthesis. A gene on chromosome 3 encodes the muscle glycogenin and this X-linked gene encodes the glycogenin mainly present in liver; both are involved in blood glucose homeostasis. This gene has a short version on chromosome Y, which is 3' truncated and can not make a functional protein. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, May 2010] Transcript Variant: This variant (5) lacks two consecutive exons in the 5' CDS, resulting in a downstream in-frame AUG start codon, and also lacks two consecutive in-frame exons in the 3' CDS, as compared to variant 2. The resulting isoform (e) has a shorter N-terminus and lacks an internal segment in the C-terminal region, as compared to isoform b. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229755 | GYG2 (Myc-DDK-tagged)-Human glycogenin 2 (GYG2), transcript variant 5 |
USD 420.00 |
|
RG229755 | GYG2 (GFP-tagged) - Human glycogenin 2 (GYG2), transcript variant 5 |
USD 460.00 |
|
RC229755L3 | Lenti-ORF clone of GYG2 (Myc-DDK-tagged)-Human glycogenin 2 (GYG2), transcript variant 5 |
USD 620.00 |
|
RC229755L4 | Lenti-ORF clone of GYG2 (mGFP-tagged)-Human glycogenin 2 (GYG2), transcript variant 5 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review