PEX11B (NM_001184795) Human Untagged Clone

CAT#: SC328395

PEX11B (untagged)-Human peroxisomal biogenesis factor 11 beta (PEX11B) transcript variant 2


  "NM_001184795" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PEX11B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PEX11B
Synonyms PEX11-BETA; PEX14B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001184795, the custom clone sequence may differ by one or more nucleotides


ATGGGGAAACTGAGGGCCGCCCAGTATGCTTGCTCTCTTCTTGGCCATGCGCTGCAGAGGCATGGAGCCA
GTCCTGAGTTACAGAAACAGATTCGACAACTGGAGAGCCACCTGAGCCTTGGAAGAAAGCTTCTACGCCT
GGGTAACTCAGCAGATGCCCTTGAGTCAGCCAAAAGAGCTGTTCACCTATCAGATGTTGTCCTGAGATTC
TGCATCACTGTTAGTCACCTCAATCGAGCCTTGTACTTCGCCTGTGACAATGTCCTGTGGGCTGGAAAGT
CTGGACTGGCTCCCCGTGTGGATCAGGAGAAGTGGGCCCAGCGTTCATTCAGGTACTATTTGTTTTCCCT
CATCATGAATTTGAGCCGTGATGCTTATGAGATTCGCCTACTGATGGAGCAAGAGTCTTCTGCTTGTAGC
CGGCGACTGAAAGGTTCTGGAGGAGGAGTCCCAGGAGGAAGTGAAACTGGGGGACTTGGGGGACCAGGGA
CTCCAGGAGGAGGTCTGCCCCAACTGGCTCTGAAACTTCGGCTGCAAGTCCTGCTCCTGGCTCGAGTCCT
TAGAGGTCATCCCCCACTTCTGCTAGACGTGGTCAGAAATGCCTGTGATCTCTTCATTCCTCTGGACAAA
CTAGGCCTCTGGCGCTGTGGCCCTGGGATTGTGGGGCTTTGTGGCCTCGTGTCCTCCATCCTGTCTATTC
TCACCCTAATCTATCCCTGGCTACGACTCAAGCCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001184795
ORF Size 738 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001184795.1, NP_001171724.1
RefSeq Size 1642
RefSeq ORF 738
Locus ID 8799
Protein Families Transmembrane
Gene Summary The protein encoded by this gene facilitates peroxisomal proliferation and interacts with PEX19. The encoded protein is found in the peroxisomal membrane. Several transcript variants, some protein-coding and some not protein-coding, have been found for this gene. [provided by RefSeq, Dec 2012]
Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) has a shorter and distinct N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.