PEX11B (NM_001184795) Human Untagged Clone
CAT#: SC328395
PEX11B (untagged)-Human peroxisomal biogenesis factor 11 beta (PEX11B) transcript variant 2
"NM_001184795" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PEX11B |
Synonyms | PEX11-BETA; PEX14B |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001184795, the custom clone sequence may differ by one or more nucleotides
ATGGGGAAACTGAGGGCCGCCCAGTATGCTTGCTCTCTTCTTGGCCATGCGCTGCAGAGGCATGGAGCCA GTCCTGAGTTACAGAAACAGATTCGACAACTGGAGAGCCACCTGAGCCTTGGAAGAAAGCTTCTACGCCT GGGTAACTCAGCAGATGCCCTTGAGTCAGCCAAAAGAGCTGTTCACCTATCAGATGTTGTCCTGAGATTC TGCATCACTGTTAGTCACCTCAATCGAGCCTTGTACTTCGCCTGTGACAATGTCCTGTGGGCTGGAAAGT CTGGACTGGCTCCCCGTGTGGATCAGGAGAAGTGGGCCCAGCGTTCATTCAGGTACTATTTGTTTTCCCT CATCATGAATTTGAGCCGTGATGCTTATGAGATTCGCCTACTGATGGAGCAAGAGTCTTCTGCTTGTAGC CGGCGACTGAAAGGTTCTGGAGGAGGAGTCCCAGGAGGAAGTGAAACTGGGGGACTTGGGGGACCAGGGA CTCCAGGAGGAGGTCTGCCCCAACTGGCTCTGAAACTTCGGCTGCAAGTCCTGCTCCTGGCTCGAGTCCT TAGAGGTCATCCCCCACTTCTGCTAGACGTGGTCAGAAATGCCTGTGATCTCTTCATTCCTCTGGACAAA CTAGGCCTCTGGCGCTGTGGCCCTGGGATTGTGGGGCTTTGTGGCCTCGTGTCCTCCATCCTGTCTATTC TCACCCTAATCTATCCCTGGCTACGACTCAAGCCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001184795 |
ORF Size | 738 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001184795.1, NP_001171724.1 |
RefSeq Size | 1642 |
RefSeq ORF | 738 |
Locus ID | 8799 |
Protein Families | Transmembrane |
Gene Summary | The protein encoded by this gene facilitates peroxisomal proliferation and interacts with PEX19. The encoded protein is found in the peroxisomal membrane. Several transcript variants, some protein-coding and some not protein-coding, have been found for this gene. [provided by RefSeq, Dec 2012] Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) has a shorter and distinct N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229757 | PEX11B (Myc-DDK-tagged)-Human peroxisomal biogenesis factor 11 beta (PEX11B), transcript variant 2 |
USD 420.00 |
|
RG229757 | PEX11B (GFP-tagged) - Human peroxisomal biogenesis factor 11 beta (PEX11B), transcript variant 2 |
USD 460.00 |
|
RC229757L3 | Lenti ORF clone of Human peroxisomal biogenesis factor 11 beta (PEX11B), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC229757L4 | Lenti ORF clone of Human peroxisomal biogenesis factor 11 beta (PEX11B), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review