PQBP1 (NM_001167990) Human Untagged Clone
CAT#: SC328414
PQBP1 (untagged)-Human polyglutamine binding protein 1 (PQBP1) transcript variant 9
"NM_001167990" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PQBP1 |
Synonyms | MRX2; MRX55; MRXS3; MRXS8; NPW38; RENS1; SHS |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001167990, the custom clone sequence may differ by one or more nucleotides
ATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCTG GAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGACGATGATCCTGTGGACTAC GAGGCCACCAGGTTGGAGGGCCTACCACCAAGCTGCGGGCTCCCTTACTACTGGAATGCA GACACAGACCTTGTATCCTGGCTCTCCCCACATGACCCCAACTCCGTGGTTACCAAATCG GCCAAGAAGCTCAGAAGCAGTAATGCAGATGCTGAAGAAAAGTTGGACCGGAGCCATGAC AAGTCGGACAGGGGCCATGACAAGTCGGACCGCAGCCATGAGAAACTAGACAGGGGCCAC GACAAGTCAGACCGGGGCCACGACAAGTCTGACAGGGATCGAGAGCGTGGCTATGACAAG GTAGACAGAGAGAGAGAGCGAGACAGGGAACGGGATCGGGACCGCGGGTATGACAAGGCA GACCGGGAAGAGGGCAAAGAACGGCGCCACCATCGCCGGGAGGAGCTGGCTCCCTATCCC AAGAGCAAGAAGGCAGTAAGCCGAAAGGATGAAGAGTTAGACCCCATGGACCCTAGCTCA TACTCAGACGCCCCCCGGGGCACGTGGTCAACAGGACTCCCCAAGCGGAATGAGGCCAAG ACTGGCGCTGACACCACAGCAGCTGGGCCCCTCTTCCAGCAGCGGCCGTATCCATCCCCA GGGGCTGTGCTCCGGGCCAATGCAGAGGCCTCCCGAACCAAGCAGCAGGATTGA |
Restriction Sites | Please inquire |
ACCN | NM_001167990 |
ORF Size | 774 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001167990.1, NP_001161462.1 |
RefSeq Size | 972 |
RefSeq ORF | 774 |
Locus ID | 10084 |
Protein Families | Transcription Factors |
Protein Pathways | Spliceosome |
Gene Summary | This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked cognitive disability. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009] Transcript Variant: This variant (9) differs in the 5' UTR and uses a different splice site in the coding region, compared to variant 1. The resulting protein (isoform 5) is shorter when it is compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229776 | PQBP1 (Myc-DDK-tagged)-Human polyglutamine binding protein 1 (PQBP1), transcript variant 9 |
USD 420.00 |
|
RG229776 | PQBP1 (GFP-tagged) - Human polyglutamine binding protein 1 (PQBP1), transcript variant 9 |
USD 460.00 |
|
RC229776L3 | Lenti-ORF clone of PQBP1 (Myc-DDK-tagged)-Human polyglutamine binding protein 1 (PQBP1), transcript variant 9 |
USD 620.00 |
|
RC229776L4 | Lenti-ORF clone of PQBP1 (mGFP-tagged)-Human polyglutamine binding protein 1 (PQBP1), transcript variant 9 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review