PHETA1 (NM_001177996) Human Untagged Clone
CAT#: SC328425
FAM109A (untagged)-Human family with sequence similarity 109 member A (FAM109A) transcript variant 1
"NM_001177996" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PHETA1 |
Synonyms | FAM109A; IPIP27A; SES1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001177996, the custom clone sequence may differ by one or more nucleotides
ATGGCCCCAGGCTCCCCTCCAGGCCCCGCGATTGCCACCATGAAGCTGAACGAGCGCAGC CTGGCCTTCTACGCCACCTGTGACGCCCCGGTGGACAATGCAGGCTTCCTGTACAAGAAG GGTGGGCGGCACGCGGCCTACCACCGGCGCTGGTTCGTGCTGCGCGGGAACATGCTCTTC TACTTCGAGGACGCTGCCAGCCGTGAGCCCGTGGGCGTCATCATCCTGGAGGGCTGCACT GTGGAGCTGGTGGAGGCCGCCGAGGAGTTCGCCTTCGCTGTGCGCTTTGCGGGGACCCGG GCGCGCACCTACGTGCTGGCCGCTGAGAGTCAGGATGCCATGGAGGGCTGGGTCAAGGCC CTGTCGCGTGCCAGCTTCGACTACCTGCGGCTGGTGGTGCGCGAGCTGGAGCAGCAGCTG GCGGCTGTACGTGGCGGGGGTGGCATGGCCCTGCCCCAGCCCCAGCCCCAGTCCCTGCCC TTGCCCCCGTCCCTGCCCTCTGCCCTGGCCCCAGTCCCATCCCTGCCTTCTGCCCCAGCC CCGGTCCCAGCCCTGCCCCTGCCCCGCCGGCCCAGTGCCCTCCCGCCCAAGGAGAATGGC TGCGCTGTCTGGAGCACTGAGGCCACCTTCAGGCCTGGACCCGAGCCCCCTCCACCACCG CCTCGCCGCCGGGCCTCGGCACCCCACGGGCCCCTGGACATGGCCCCCTTCGCCCGGCTG CACGAGTGCTATGGCCAGGAGATCCGGGCCCTGCGTGGCCAGTGGCTCAGCAGCCGGGTC CAGCCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001177996 |
ORF Size | 789 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001177996.1, NP_001171467.1 |
RefSeq Size | 3256 |
RefSeq ORF | 789 |
Locus ID | 144717 |
Gene Summary | This gene encodes a protein that localizes to the endosome and interacts with the enzyme, inositol polyphosphate 5-phosphatase OCRL-1. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229787 | FAM109A (Myc-DDK-tagged)-Human family with sequence similarity 109, member A (FAM109A), transcript variant 1 |
USD 420.00 |
|
RG229787 | FAM109A (GFP-tagged) - Human family with sequence similarity 109, member A (FAM109A), transcript variant 1 |
USD 460.00 |
|
RC229787L3 | Lenti-ORF clone of FAM109A (Myc-DDK-tagged)-Human family with sequence similarity 109, member A (FAM109A), transcript variant 1 |
USD 620.00 |
|
RC229787L4 | Lenti-ORF clone of FAM109A (mGFP-tagged)-Human family with sequence similarity 109, member A (FAM109A), transcript variant 1 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review