PHETA1 (NM_001177996) Human Untagged Clone

CAT#: SC328425

FAM109A (untagged)-Human family with sequence similarity 109 member A (FAM109A) transcript variant 1


  "NM_001177996" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PHETA1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PHETA1
Synonyms FAM109A; IPIP27A; SES1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001177996, the custom clone sequence may differ by one or more nucleotides
ATGGCCCCAGGCTCCCCTCCAGGCCCCGCGATTGCCACCATGAAGCTGAACGAGCGCAGC
CTGGCCTTCTACGCCACCTGTGACGCCCCGGTGGACAATGCAGGCTTCCTGTACAAGAAG
GGTGGGCGGCACGCGGCCTACCACCGGCGCTGGTTCGTGCTGCGCGGGAACATGCTCTTC
TACTTCGAGGACGCTGCCAGCCGTGAGCCCGTGGGCGTCATCATCCTGGAGGGCTGCACT
GTGGAGCTGGTGGAGGCCGCCGAGGAGTTCGCCTTCGCTGTGCGCTTTGCGGGGACCCGG
GCGCGCACCTACGTGCTGGCCGCTGAGAGTCAGGATGCCATGGAGGGCTGGGTCAAGGCC
CTGTCGCGTGCCAGCTTCGACTACCTGCGGCTGGTGGTGCGCGAGCTGGAGCAGCAGCTG
GCGGCTGTACGTGGCGGGGGTGGCATGGCCCTGCCCCAGCCCCAGCCCCAGTCCCTGCCC
TTGCCCCCGTCCCTGCCCTCTGCCCTGGCCCCAGTCCCATCCCTGCCTTCTGCCCCAGCC
CCGGTCCCAGCCCTGCCCCTGCCCCGCCGGCCCAGTGCCCTCCCGCCCAAGGAGAATGGC
TGCGCTGTCTGGAGCACTGAGGCCACCTTCAGGCCTGGACCCGAGCCCCCTCCACCACCG
CCTCGCCGCCGGGCCTCGGCACCCCACGGGCCCCTGGACATGGCCCCCTTCGCCCGGCTG
CACGAGTGCTATGGCCAGGAGATCCGGGCCCTGCGTGGCCAGTGGCTCAGCAGCCGGGTC
CAGCCCTGA
Restriction Sites Please inquire     
ACCN NM_001177996
ORF Size 789 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001177996.1, NP_001171467.1
RefSeq Size 3256
RefSeq ORF 789
Locus ID 144717
Gene Summary This gene encodes a protein that localizes to the endosome and interacts with the enzyme, inositol polyphosphate 5-phosphatase OCRL-1. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.