MYD88 (NM_001172568) Human Untagged Clone

CAT#: SC328428

MYD88 (untagged)-Human myeloid differentiation primary response gene (88) (MYD88) transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MYD88
• Synonyms: MYD88D
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001172568, the custom clone sequence may differ by one or more nucleotides
  ATGCGACCCGACCGCGCTGAGGCTCCAGGACCGCCCGCCATGGCTGCAGGAGGTCCCGGC
  GCGGGGTCTGCGGCCCCGGTCTCCTCCACATCCTCCCTTCCCCTGGCTGCTCTCAACATG
  CGAGTGCGGCGCCGCCTGTCTCTGTTCTTGAACGTGCGGACACAGGTGGCGGCCGACTGG
  ACCGCGCTGGCGGAGGAGATGGACTTTGAGTACTTGGAGATCCGGCAACTGGAGACACAA
  GCGGACCCCACTGGCAGGCTGCTGGACGCCTGGCAGGGACGCCCTGGCGCCTCTGTAGGC
  CGACTGCTCGAGCTGCTTACCAAGCTGGGCCGCGACGACGTGCTGCTGGAGCTGGGACCC
  AGCATTGGGCATATGCCTGAGCGTTTCGATGCCTTCATCTGCTATTGCCCCAGCGACATC
  CAGTTTGTGCAGGAGATGATCCGGCAACTGGAACAGACAAACTATCGACTGAAGTTGTGT
  GTGTCTGACCGCGATGTCCTGCCTGGCACCTGTGTCTGGTCTATTGCTAGTGAGCTCATC
  GAAAAGAGGTGCCGCCGGATGGTGGTGGTTGTCTCTGATGATTACCTGCAGAGCAAGGAA
  TGTGACTTCCAGACCAAATTTGCACTCAGCCTCTCTCCAGGTGCCCATCAGAAGCGACTG
  ATCCCCATCAAGTACAAGGCAATGAAGAAAGAGTTCCCCAGCATCCTGAGGTTCATCACT
  GTCTGCGACTACACCAACCCCTGCACCAAATCTTGGTTCTGGACTCGCCTTGCCAAGGCC
  TTGTCCCTGCCCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001172568
• ORF Size: 795 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001172568.1, NP_001166039.1
• RefSeq Size: 2727
• RefSeq ORF: 795
• Locus ID: 4615
• Protein Families: Druggable Genome
• Protein Pathways: Apoptosis, Toll-like receptor signaling pathway
• Gene Summary: This gene encodes a cytosolic adapter protein that plays a central role in the innate and adaptive immune response. This protein functions as an essential signal transducer in the interleukin-1 and Toll-like receptor signaling pathways. These pathways regulate that activation of numerous proinflammatory genes. The encoded protein consists of an N-terminal death domain and a C-terminal Toll-interleukin1 receptor domain. Patients with defects in this gene have an increased susceptibility to pyogenic bacterial infections. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
  Transcript Variant: This variant (3) has multiple differences in the coding region but maintains the reading frame, compared to variant 1. This variant encodes isoform 3, which is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: The coding region has been updated to shorten the N-terminus, using a downstream start codon that is better supported by available conservation data and peptide data.