CD84 (NM_001184881) Human Untagged Clone

CAT#: SC328442

CD84 (untagged)-Human CD84 molecule (CD84) transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CD84
• Synonyms: hCD84; LY9B; mCD84; SLAMF5
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001184881, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTCAGCACCACCTATGGATCTTGCTCCTTTGCCTGCAAACCTGGCCGGAAGCAGCTGGAAAAGACT
  CAGAAATCTTCACAGTGAATGGGATTCTGGGAGAGTCAGTCACTTTCCCTGTAAATATCCAAGAACCACG
  GCAAGTTAAAATCATTGCTTGGACTTCTAAAACATCTGTTGCTTATGTAACACCAGGAGACTCAGAAACA
  GCACCCGTAGTTACTGTGACCCACAGAAATTATTATGAACGGATACATGCCTTAGGTCCGAACTACAATC
  TGGTCATTAGCGATCTGAGGATGGAAGACGCAGGAGACTACAAAGCAGACATAAATACACAGGCTGATCC
  CTACACCACCACCAAGCGCTACAACCTGCAAATCTATCGTCGGCTTGGGAAACCAAAAATTACACAGAGT
  TTAATGGCATCTGTGAACAGCACCTGTAATGTCACACTGACATGCTCTGTAGAGAAAGAAGAAAAGAATG
  TGACATACAATTGGAGTCCCCTGGGAGAAGAGGGTAATGTCCTTCAAATCTTCCAGACTCCTGAGGACCA
  AGAGCTGACTTACACGTGTACAGCCCAGAACCCTGTCAGCAACAATTCTGACTCCATCTCTGCCCGGCAG
  CTCTGTGCAGACATCGCAATGGGCTTCCGTACTCACCACACCGGGTTGCTGAGCGTGCTGGCTATGTTCT
  TTCTGCTTGTTCTCATTCTGTCTTCAGTGTTTTTGTTCCGTTTGTTCAAGAGAAGACAAGGTGCTTCCCT
  CCAAGGAAGAGCCAGTGAACACAGTTTATTCCGAAGTGCAGTTTGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001184881
• ORF Size: 819 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001184881.1, NP_001171810.1
• RefSeq Size: 8147
• RefSeq ORF: 819
• Locus ID: 8832
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: This gene encodes a membrane glycoprotein that is a member of the signaling lymphocyte activation molecule (SLAM) family. This family forms a subset of the larger CD2 cell-surface receptor Ig superfamily. The encoded protein is a homophilic adhesion molecule that is expressed in numerous immune cells types and is involved in regulating receptor-mediated signaling in those cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
  Transcript Variant: This variant (3) lacks two alternate segments, one of which shifts the reading frame, compared to variant 1. The resulting protein (isoform 3) has a shorter and distinct C-terminus when it is compared to isoform 1. This variant has also been called CD84d. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.